DNASU Plasmid Repository • 480.965.5697 | Email

TRAF6 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TRAF6
Gene Name:  TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Sequence             
Original Clone ID: HR6399A-216-340-15.3
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
PSI:Biology
HsCD00583843

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 381nts         Open reading frame : 31 to 411
Reference Sequence Alignment

ATGGGCCATCACCATCACCATCACAGCCATATGGAATACTGCAATACTATACTCATCAGA
GAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATTCCATGCACATTC
AGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGCCACCTACAAGAG
AACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTGAGCGTTATACCC
GACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGT
CGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGT
ATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR6399A
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TRAF6
Symbol Nomenclature : TRAF6
SYNONYM : MGC:3310; RNF85
Designation : E3 ubiquitin-protein ligase TRAF6|RING finger protein 85|TNF receptor-associated factor 6|interleukin-1 signal transducer
Full Nomenclature : TNF receptor-associated factor 6, E3 ubiquitin protein ligase
GENEID : 7189
GI : 22027630
GenBank Accession : NM_145803
HGNC : 12036
MIM : 602355
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00583843      ------------------------------------------------------------
NM_004620.3       ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTGCTGT
NM_145803.2       ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTGCTGT
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCC
NM_145803.2       GTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCC
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       AGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTT
NM_145803.2       AGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTT
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCA
NM_145803.2       GACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCA
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT
NM_145803.2       GTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGAC
NM_145803.2       GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGAC
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       AATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTG
NM_145803.2       AATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTG
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       CACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATG
NM_145803.2       CACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATG
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAG
NM_145803.2       GATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAG
                                                                              

HsCD00583843      ---------------------------------------------------------ATG
NM_004620.3       GATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT
NM_145803.2       GATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT
                                                                           .: 

HsCD00583843      GGCCATCACCATCACCATCACAGCCATATG---------------GAATACTGCAATACT
NM_004620.3       AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACT
NM_145803.2       AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACT
                  ... * .:**** **** .**:* *.*:**               ***************

HsCD00583843      ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
NM_004620.3       ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
NM_145803.2       ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
                  ************************************************************

HsCD00583843      CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
NM_004620.3       CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
NM_145803.2       CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
                  ************************************************************

HsCD00583843      CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
NM_004620.3       CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
NM_145803.2       CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
                  ************************************************************

HsCD00583843      AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
NM_004620.3       AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
NM_145803.2       AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
                  ************************************************************

HsCD00583843      CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
NM_004620.3       CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
NM_145803.2       CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
                  ************************************************************

HsCD00583843      GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
NM_004620.3       GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
NM_145803.2       GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
                  ************************************************************

HsCD00583843      TAG---------------------------------------------------------
NM_004620.3       GTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTT
NM_145803.2       GTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTT
                   :                                                          

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTC
NM_145803.2       GGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTC
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       TACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT
NM_145803.2       TACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGC
NM_145803.2       CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGC
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       CACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCA
NM_145803.2       CACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCA
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       CCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAG
NM_145803.2       CCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAG
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       CGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAA
NM_145803.2       CGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAA
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       GCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC
NM_145803.2       GCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC
                                                                              

HsCD00583843      ------------------------------------------------------------
NM_004620.3       ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCA
NM_145803.2       ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCA
                                                                              

HsCD00583843      ---------
NM_004620.3       GGGGTATAG
NM_145803.2       GGGGTATAG
                           

Pathways

NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : Canonical NF-kappaB pathway
NCI : IL1-mediated signaling events
NCI : Regulation of p38-alpha and p38-beta
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : p38 MAPK signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : Toll receptor signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Adaptive Immune System
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cytokine Signaling in Immune system
Reactome : Downstream TCR signaling
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IKK complex recruitment mediated by RIP1
Reactome : IRAK1 recruits IKK complex
Reactome : IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NF-kB is activated and signals survival
Reactome : NOD1/2 Signaling Pathway
Reactome : NRIF signals cell death from the nucleus
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulated proteolysis of p75NTR
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signalling by NGF
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TCR signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-1 signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

Structural Annotation Wiki : HR6399A
UniProt : Q9Y4K3
HPRD : 03833

Clone

Cloning Information : 627033
Original Clone ID : HR6399A-216-340-15.3

Experimental

TargetTrack - Experimental data : HR6399A

Organism


TAX_ID : 9606
Species Specific ID: 7189

Genome

Chromosome : 11
Map Location : 11p12

Reagents

Labome : TRAF6-antibody