DNASU Plasmid Repository • 480.965.5697 | Email

ARHGEF6 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARHGEF6
Gene Name:  Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Sequence             
Original Clone ID: HR4654B-230-399-15.1
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
PSI:Biology
HsCD00585017

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 516nts         Open reading frame : 31 to 546
Reference Sequence Alignment

ATGGGCCATCACCATCACCATCACAGCCATATGAAAGGATTTGAAACTGCTCCACTTACC
AAGAATTATTATACTGTGGTGTTACAGAACATCCTGGACACTGAAAAAGAATATGCTAAA
GAACTTCAGTCTCTTCTTGTTACTTACTTAAGACCCCTGCAGTCCAATAACAATCTGAGT
ACTGTGGAGGTTACATCTTTACTGGGAAACTTCGAGGAAGTATGCACATTTCAACAGACA
CTCTGCCAAGCCTTGGAAGAATGTTCAAAGTTTCCAGAAAACCAGCACAAAGTAGGAGGT
TGTCTACTGAGTCTCATGCCTCATTTTAAATCTATGTATCTGGCTTACTGTGCAAACCAT
CCTTCAGCTGTAAATGTGCTCACTCAGCACAGTGATGAGTTGGAACAATTCATGGAAAAT
CAAGGTGCATCGAGCCCAGGTATCCTCATTTTAACAACAAACCTCAGCAAACCATTCATG
CGACTGGAGAAATATGTTACTCTCTTGCAAGAGTTAGAACGGCATATGGAGGATACTCAT
CCATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in HR4654B
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARHGEF6
Symbol Nomenclature : ARHGEF6
SYNONYM : COOL2; Cool-2; MRX46; PIXA; alpha-PIX; alphaPIX
Designation : PAK-interacting exchange factor alpha|PAK-interacting exchange factor, alpha|Rac/Cdc42 guanine exchange factor (GEF) 6|rac/Cdc42 guanine nucleotide exchange factor 6|rho guanine nucleotide exchange factor 6
Full Nomenclature : Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
GENEID : 9459
Locus Tag : RP3-527F8.4
GI : 22027525
GenBank Accession : NM_004840
HGNC : 685
MIM : 300267
Vega : OTTHUMG00000022518
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00585017        ------------------------------------------------------------
NM_004840.2         ATGAATCCAGAAGAACAAATCGTGACATGGCTTATATCTTTGGGAGTTTTAGAGTCCCCT
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      ATGAATCCAGAAGAACAAATCGTGACATGGCTTATATCTTTGGGAGTTTTAGAGTCCCCT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AAAAAGACCATCTGTGATCCGGAGGAGTTTTTAAAGTCCTCGCTGAAAAATGGGGTAGTT
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      AAAAAGACCATCTGTGATCCGGAGGAGTTTTTAAAGTCCTCGCTGAAAAATGGGGTAGTT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CTGTGCAAACTGATCAACAGACTCATGCCTGGCTCTGTGGAAAAGTTTTGTCTGGATCCC
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      CTGTGCAAACTGATCAACAGACTCATGCCTGGCTCTGTGGAAAAGTTTTGTCTGGATCCC
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CAAACTGAAGCTGACTGCATCAACAACATCAATGACTTCCTGAAAGGATGTGCAACCCTC
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      CAAACTGAAGCTGACTGCATCAACAACATCAATGACTTCCTGAAAGGATGTGCAACCCTC
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CAAGTGGAAATATTTGATCCTGATGACCTTTATTCAGGGGTCAATTTCTCCAAGGTACTG
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      CAAGTGGAAATATTTGATCCTGATGACCTTTATTCAGGGGTCAATTTCTCCAAGGTACTG
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AGTACTCTTTTAGCTGTCAACAAAGCAACAGAAGATCAGCTATCAGAAAGACCATGTGGA
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      AGTACTCTTTTAGCTGTCAACAAAGCAACAGAAGATCAGCTATCAGAAAGACCATGTGGA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CGTTCCTCTTCTCTTAGTGCTGCTAATACTTCTCAGACAAACCCACAGGGAGCAGTTTCT
XM_005262501.1      ------------------------------------------------------------
XM_005262499.1      CGTTCCTCTTCTCTTAGTGCTGCTAATACTTCTCAGACAAACCCACAGGGAGCAGTTTCT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AGCACAGTTTCAGGGCTGCAAAGGCAGTCAAAGACAGTGGAGATGACGGAAAATGGAAGT
XM_005262501.1      ------------------------------------------ATGACGGAAAATGGAAGT
XM_005262499.1      AGCACAGTTTCAGGGCTGCAAAGGCAGTCAAAGACAGTGGAGATGACGGAAAATGGAAGT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CATCAGTTGATAGTAAAAGCAAGATTCAACTTTAAGCAGACTAATGAGGATGAACTGTCA
XM_005262501.1      CATCAGTTGATAGTAAAAGCAAGATTCAACTTTAAGCAGACTAATGAGGATGAACTGTCA
XM_005262499.1      CATCAGTTGATAGTAAAAGCAAGATTCAACTTTAAGCAGACTAATGAGGATGAACTGTCA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GTTTGTAAGGGGGACATCATTTACGTCACACGAGTTGAAGAAGGAGGCTGGTGGGAAGGC
XM_005262501.1      GTTTGTAAGGGGGACATCATTTACGTCACACGAGTTGAAGAAGGAGGCTGGTGGGAAGGC
XM_005262499.1      GTTTGTAAGGGGGACATCATTTACGTCACACGAGTTGAAGAAGGAGGCTGGTGGGAAGGC
                                                                                

HsCD00585017        ------------------------------------------------------ATGGGC
NM_004840.2         ACATTAAATGGGAGAACAGGCTGGTTCCCCAGTAATTATGTCCGTGAAATTAAATCCAGT
XM_005262501.1      ACATTAAATGGGAGAACAGGCTGGTTCCCCAGTAATTATGTCCGTGAAATTAAATCCAGT
XM_005262499.1      ACATTAAATGGGAGAACAGGCTGGTTCCCCAGTAATTATGTCCGTGAAATTAAATCCAGT
                                                                          :  .* 

HsCD00585017        CATCACCATCACCATCACAGCCATATGAAAGGATTTGAAACTGCTCCACTTACCAAGAAT
NM_004840.2         GAGAGACCTCTCTCCCCAAAAGCCGTCAAAGGATTTGAAACTGCTCCACTTACCAAGAAT
XM_005262501.1      GAGAGACCTCTCTCCCCAAAAGCCGTCAAAGGATTTGAAACTGCTCCACTTACCAAGAAT
XM_005262499.1      GAGAGACCTCTCTCCCCAAAAGCCGTCAAAGGATTTGAAACTGCTCCACTTACCAAGAAT
                     * ...*.**:* . *..*.. . .* *********************************

HsCD00585017        TATTATACTGTGGTGTTACAGAACATCCTGGACACTGAAAAAGAATATGCTAAAGAACTT
NM_004840.2         TATTATACTGTGGTGTTACAGAACATCCTGGACACTGAAAAAGAATATGCTAAAGAACTT
XM_005262501.1      TATTATACTGTGGTGTTACAGAACATCCTGGACACTGAAAAAGAATATGCTAAAGAACTT
XM_005262499.1      TATTATACTGTGGTGTTACAGAACATCCTGGACACTGAAAAAGAATATGCTAAAGAACTT
                    ************************************************************

HsCD00585017        CAGTCTCTTCTTGTTACTTACTTAAGACCCCTGCAGTCCAATAACAATCTGAGTACTGTG
NM_004840.2         CAGTCTCTTCTTGTTACTTACTTAAGACCCCTGCAGTCCAATAACAATCTGAGTACTGTG
XM_005262501.1      CAGTCTCTTCTTGTTACTTACTTAAGACCCCTGCAGTCCAATAACAATCTGAGTACTGTG
XM_005262499.1      CAGTCTCTTCTTGTTACTTACTTAAGACCCCTGCAGTCCAATAACAATCTGAGTACTGTG
                    ************************************************************

HsCD00585017        GAGGTTACATCTTTACTGGGAAACTTCGAGGAAGTATGCACATTTCAACAGACACTCTGC
NM_004840.2         GAGGTTACATCTTTACTGGGAAACTTCGAGGAAGTATGCACATTTCAACAGACACTCTGC
XM_005262501.1      GAGGTTACATCTTTACTGGGAAACTTCGAGGAAGTATGCACATTTCAACAGACACTCTGC
XM_005262499.1      GAGGTTACATCTTTACTGGGAAACTTCGAGGAAGTATGCACATTTCAACAGACACTCTGC
                    ************************************************************

HsCD00585017        CAAGCCTTGGAAGAATGTTCAAAGTTTCCAGAAAACCAGCACAAAGTAGGAGGTTGTCTA
NM_004840.2         CAAGCCTTGGAAGAATGTTCAAAGTTTCCAGAAAACCAGCACAAAGTAGGAGGTTGTCTA
XM_005262501.1      CAAGCCTTGGAAGAATGTTCAAAGTTTCCAGAAAACCAGCACAAAGTAGGAGGTTGTCTA
XM_005262499.1      CAAGCCTTGGAAGAATGTTCAAAGTTTCCAGAAAACCAGCACAAAGTAGGAGGTTGTCTA
                    ************************************************************

HsCD00585017        CTGAGTCTCATGCCTCATTTTAAATCTATGTATCTGGCTTACTGTGCAAACCATCCTTCA
NM_004840.2         CTGAGTCTCATGCCTCATTTTAAATCTATGTATCTGGCTTACTGTGCAAACCATCCTTCA
XM_005262501.1      CTGAGTCTCATGCCTCATTTTAAATCTATGTATCTGGCTTACTGTGCAAACCATCCTTCA
XM_005262499.1      CTGAGTCTCATGCCTCATTTTAAATCTATGTATCTGGCTTACTGTGCAAACCATCCTTCA
                    ************************************************************

HsCD00585017        GCTGTAAATGTGCTCACTCAGCACAGTGATGAGTTGGAACAATTCATGGAAAATCAAGGT
NM_004840.2         GCTGTAAATGTGCTCACTCAGCACAGTGATGAGTTGGAACAATTCATGGAAAATCAAGGT
XM_005262501.1      GCTGTAAATGTGCTCACTCAGCACAGTGATGAGTTGGAACAATTCATGGAAAATCAAGGT
XM_005262499.1      GCTGTAAATGTGCTCACTCAGCACAGTGATGAGTTGGAACAATTCATGGAAAATCAAGGT
                    ************************************************************

HsCD00585017        GCATCGAGCCCAGGTATCCTCATTTTAACAACAAACCTCAGCAAACCATTCATGCGACTG
NM_004840.2         GCATCGAGCCCAGGTATCCTCATTTTAACAACAAACCTCAGCAAACCATTCATGCGACTG
XM_005262501.1      GCATCGAGCCCAGGTATCCTCATTTTAACAACAAACCTCAGCAAACCATTCATGCGACTG
XM_005262499.1      GCATCGAGCCCAGGTATCCTCATTTTAACAACAAACCTCAGCAAACCATTCATGCGACTG
                    ************************************************************

HsCD00585017        GAGAAATATGTTACTCTCTTGCAAGAGTTAGAACGGCATATGGAGGATACTCATCCATAG
NM_004840.2         GAGAAATATGTTACTCTCTTGCAAGAGTTAGAACGGCATATGGAGGATACTCATCCAGAT
XM_005262501.1      GAGAAATATGTTACTCTCTTGCAAGAGTTAGAACGGCATATGGAGGATACTCATCCAGAT
XM_005262499.1      GAGAAATATGTTACTCTCTTGCAAGAGTTAGAACGGCATATGGAGGATACTCATCCAGAT
                    ********************************************************* * 

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CATCAGGATATTCTGAAAGCAATCGTAGCATTCAAAACTCTCATGGGGCAATGTCAAGAT
XM_005262501.1      CATCAGGATATTCTGAAAGCAATCGTAGCATTCAAAACTCTCATGGGGCAATGTCAAGAT
XM_005262499.1      CATCAGGATATTCTGAAAGCAATCGTAGCATTCAAAACTCTCATGGGGCAATGTCAAGAT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CTGAGGAAGAGAAAACAGCTGGAGTTACAGATACTGTCCGAACCTATTCAGGCATGGGAA
XM_005262501.1      CTGAGGAAGAGAAAACAGCTGGAGTTACAGATACTGTCCGAACCTATTCAGGCATGGGAA
XM_005262499.1      CTGAGGAAGAGAAAACAGCTGGAGTTACAGATACTGTCCGAACCTATTCAGGCATGGGAA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GGAGAAGATATTAAAAACTTGGGAAATGTGATTTTTATGTCACAAGTAATGGTGCAGTAT
XM_005262501.1      GGAGAAGATATTAAAAACTTGGGAAATGTGATTTTTATGTCACAAGTAATGGTGCAGTAT
XM_005262499.1      GGAGAAGATATTAAAAACTTGGGAAATGTGATTTTTATGTCACAAGTAATGGTGCAGTAT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GGAGCATGTGAGGAAAAAGAGGAGCGGTACCTTATGTTATTTTCAAATGTCCTGATAATG
XM_005262501.1      GGAGCATGTGAGGAAAAAGAGGAGCGGTACCTTATGTTATTTTCAAATGTCCTGATAATG
XM_005262499.1      GGAGCATGTGAGGAAAAAGAGGAGCGGTACCTTATGTTATTTTCAAATGTCCTGATAATG
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         TTATCTGCAAGTCCTCGGATGAGTGGCTTTATCTATCAGGGAAAAATACCAATAGCAGGA
XM_005262501.1      TTATCTGCAAGTCCTCGGATGAGTGGCTTTATCTATCAGGGAAAAATACCAATAGCAGGA
XM_005262499.1      TTATCTGCAAGTCCTCGGATGAGTGGCTTTATCTATCAGGGAAAAATACCAATAGCAGGA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         ACGGTGGTGACTAGATTAGATGAAATTGAAGGGAATGACTGCACATTTGAAATCACTGGT
XM_005262501.1      ACGGTGGTGACTAGATTAGATGAAATTGAAGGGAATGACTGCACATTTGAAATCACTGGT
XM_005262499.1      ACGGTGGTGACTAGATTAGATGAAATTGAAGGGAATGACTGCACATTTGAAATCACTGGT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AACACAGTGGAGAGAATTGTGGTCCATTGTAACAACAACCAGGACTTCCAGGAATGGTTG
XM_005262501.1      AACACAGTGGAGAGAATTGTGGTCCATTGTAACAACAACCAGGACTTCCAGGAATGGTTG
XM_005262499.1      AACACAGTGGAGAGAATTGTGGTCCATTGTAACAACAACCAGGACTTCCAGGAATGGTTG
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GAGCAGCTGAACAGACTGATCAGAGGACCTGCCTCTTGCAGTTCATTATCCAAAACCTCA
XM_005262501.1      GAGCAGCTGAACAGACTGATCAGAGGACCTGCCTCTTGCAGTTCATTATCCAAAACCTCA
XM_005262499.1      GAGCAGCTGAACAGACTGATCAGAGGACCTGCCTCTTGCAGTTCATTATCCAAAACCTCA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         TCGTCATCATGTAGTGCTCATTCTTCTTTTAGCTCTACCGGACAGCCCCGAGGACCCTTG
XM_005262501.1      TCGTCATCATGTAGTGCTCATTCTTCTTTTAGCTCTACCGGACAGCCCCGAGGACCCTTG
XM_005262499.1      TCGTCATCATGTAGTGCTCATTCTGAG---------------------------------
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GAGCCTCCTCAAATTATAAAACCGTGGAGTTTAAGTTGTCTACGACCTGCACCTCCACTT
XM_005262501.1      GAGCCTCCTCAAATTATAAAACCGTGGAGTTTAAGTTGTCTACGACCTGCACCTCCACTT
XM_005262499.1      ------------------------------------------------------------
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AGACCATCAGCAGCACTAGGTTATAAAGAGAGGATGTCTTATATCTTAAAGGAGTCTAGT
XM_005262501.1      AGACCATCAGCAGCACTAGGTTATAAAGAGAGGATGTCTTATATCTTAAAGGAGTCTAGT
XM_005262499.1      ------------------------------------------------------TCTAGT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AAAAGCCCTAAAACGATGAAGAAATTTCTTCATAAAAGGAAGACTGAGAGAAAACCATCG
XM_005262501.1      AAAAGCCCTAAAACGATGAAGAAATTTCTTCATAAAAGGAAGACTGAGAGAAAACCATCG
XM_005262499.1      AAAAGCCCTAAAACGATGAAGAAATTTCTTCATAAAAGGAAGACTGAGAGAAAACCATCG
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GAGGAGGAATATGTGATTAGGAAAAGTACAGCTGCTCTGGAAGAGGATGCTCAAATCCTT
XM_005262501.1      GAGGAGGAATATGTGATTAGGAAAAGTACAGCTGCTCTGGAAGAGGATGCTCAAATCCTT
XM_005262499.1      GAGGAGGAATATGTGATTAGGAAAAGTACAGCTGCTCTGGAAGAGGATGCTCAAATCCTT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         AAAGTGATCGAAGCCTACTGCACCAGCGCAAATTTTCAACAAGGCCATGGCTCAAGTACT
XM_005262501.1      AAAGTGATCGAAGCCTACTGCACCAGCGCAAATTTTCAACAAGGCCATGGCTCAAGTACT
XM_005262499.1      AAAGTGATCGAAGCCTACTGCACCAGCGCAAATTTTCAACAAGGCCATGGCTCAAGTACT
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         CGAAAAGATTCCATTCCACAAGTCCTACTCCCTGAGGAAGAGAAACTCATCATTGAAGAA
XM_005262501.1      CGAAAAGATTCCATTCCACAAGTCCTACTCCCTGAGGAAGAGAAACTCATCATTGAAGAA
XM_005262499.1      CGAAAAGATTCCATTCCACAAGTCCTACTCCCTGAGGAAGAGAAACTCATCATTGAAGAA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         ACCAGAAGCAACGGCCAGACCATCATGGAAGAAAAGAGCCTTGTTGATACTGTTTACGCC
XM_005262501.1      ACCAGAAGCAACGGCCAGACCATCATGGAAGAAAAGAGCCTTGTTGATACTGTTTACGCC
XM_005262499.1      ACCAGAAGCAACGGCCAGACCATCATGGAAGAAAAGAGCCTTGTTGATACTGTTTACGCC
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         TTGAAGGACGAGGTCAGAGAACTGAAGCAGGAAAATAAAAGAATGAAGCAATGCCTGGAA
XM_005262501.1      TTGAAGGACGAGGTCAGAGAACTGAAGCAGGAAAATAAAAGAATGAAGCAATGCCTGGAA
XM_005262499.1      TTGAAGGACGAGGTCAGAGAACTGAAGCAGGAAAATAAAAGAATGAAGCAATGCCTGGAA
                                                                                

HsCD00585017        ------------------------------------------------------------
NM_004840.2         GAAGAACTGAAATCAAGAAGGGACCTAGAAAAGCTGGTGCGGAGGCTTTTGAAGCAAACA
XM_005262501.1      GAAGAACTGAAATCAAGAAGGGACCTAGAAAAGCTGGTGCGGAGGCTTTTGAAGCAAACA
XM_005262499.1      GAAGAACTGAAATCAAGAAGGGACCTAGAAAAGCTGGTGCGGAGGCTTTTGAAGCAAACA
                                                                                

HsCD00585017        ---------------------------------------------------
NM_004840.2         GATGAGTGTATTCGAGGCGAGTCCAGTAGCAAGACCTCAATTCTTCCATAA
XM_005262501.1      GATGAGTGTATTCGAGGCGAGTCCAGTAGCAAGACCTCAATTCTTCCATAA
XM_005262499.1      GATGAGTGTATTCGAGGCGAGTCCAGTAGCAAGACCTCAATTCTTCCATAA
                                                                       

Pathways

NCI : CDC42 signaling events
NCI : Integrin-linked kinase signaling
NCI : Regulation of CDC42 activity
NCI : Regulation of RAC1 activity
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Cell-extracellular matrix interactions
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : NRAGE signals death through JNK
Reactome : Regulation of cytoskeletal remodeling and cell spreading by IPP complex components
Reactome : Rho GTPase cycle
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Rho GTPases
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Regulation of Actin Cytoskeleton

Protein

SMART domain : RhoGEF : Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases
Structural Annotation Wiki : HR4654B
UniProt : Q15052
HPRD : 02226

Clone

Cloning Information : 626790
Original Clone ID : HR4654B-230-399-15.1

Experimental

TargetTrack - Experimental data : HR4654B

Organism


TAX_ID : 9606
Species Specific ID: 9459

Genome

Chromosome : X
Map Location : Xq26.3
Ensembl : ENSG00000129675

Reagents

Labome : ARHGEF6-antibody