DNASU Plasmid Repository • 480.965.5697 | Email

NCOA1 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NCOA1
Gene Name:  nuclear receptor coactivator 1
Sequence             
Original Clone ID: HR3639G-107-179-15.31
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
PSI:Biology
HsCD00585033

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 225nts         Open reading frame : 51 to 275

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGATAGAAA
AGGAATCCTTGGGACCTCTTCTTTTGGAGGCTTTGGATGGATTTTTCTTTGTTGTGAACT
GTGAAGGGAGAATTGTATTTGTGTCAGAGAATGTAACCAGCTACTTAGGTTACAATCAGG
AGGAATTAATGAATACCAGCGTCTACAGCATACTGCACGTGGGGGATCATGCAGAATTTG
TGAAGAATCTGCTACCAAAATCACTAGTAAATTAGCTCGAGATCCGGCTGCTAACAAAGC
CCGAAAGGAAGCTGAGTTGGCTGCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in HR3639G
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NCOA1
Symbol Nomenclature : NCOA1
SYNONYM : F-SRC-1; KAT13A; RIP160; SRC1; bHLHe42; bHLHe74
Designation : Hin-2 protein|PAX3/NCOA1 fusion protein|class E basic helix-loop-helix protein 74|renal carcinoma antigen NY-REN-52|steroid receptor coactivator-1
Full Nomenclature : nuclear receptor coactivator 1
GENEID : 8648
GI : 22538459
GenBank Accession : NM_147233
HGNC : 7668
MIM : 602691
Vega : OTTHUMG00000125523
Target GenBank: None

 

Pathways

NCI : Glucocorticoid receptor regulatory network
NCI : HIF-1-alpha transcription factor network
NCI : Notch-mediated HES/HEY network
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Regulation of Androgen receptor activity
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Retinoic acid receptors-mediated signaling
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated nuclear estrogen receptor beta network
Reactome : Activation of gene expression by SREBF (SREBP)
Reactome : BMAL1:CLOCK,NPAS2 activates circadian gene expression
Reactome : Circadian Clock
Reactome : Developmental Biology
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Mitochondrial biogenesis
Reactome : Organelle biogenesis and maintenance
Reactome : PPARA activates gene expression
Reactome : REV-ERBA represses gene expression
Reactome : RORA activates circadian gene expression
Reactome : Regulation of cholesterol biosynthesis by SREBP (SREBF)
Reactome : Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha)
Reactome : Transcriptional activation of mitochondrial biogenesis
Reactome : Transcriptional regulation of white adipocyte differentiation
Reactome : YAP1- and WWTR1 (TAZ)-stimulated gene expression
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Energy Metabolism
WikiPathway : IL-6 signaling pathway
WikiPathway : Leptin signaling pathway

Protein

SMART domain : PAS : PAS domain
Structural Annotation Wiki : HR3639G
UniProt : Q15788
HPRD : 04070

Clone

Cloning Information : 626740
Original Clone ID : HR3639G-107-179-15.31

Experimental

TargetTrack - Experimental data : HR3639G

Organism


TAX_ID : 9606
Species Specific ID: 8648

Genome

Chromosome : 2
Map Location : 2p23
Ensembl : ENSG00000084676

Reagents

Labome : SRC-1-antibody