DNASU Plasmid Repository • 480.965.5697 | Email

ACTL6A (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ACTL6A
Gene Name:  actin-like 6A
Sequence             
Original Clone ID: HR2893A-55-429-14.33
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Rutgers University
PSI:Biology
Northeast Structural Genomics Consortium
HsCD00589647

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 1131nts         Open reading frame : 26 to 1156
Reference Sequence Alignment

CCATCACCATCACCATCACAGCCATATGGAAATAGATGGCGATAAAGGCAAACAAGGCGG
TCCCACCTACTACATAGATACTAATGCTCTGCGTGTTCCGAGGGAGAATATGGAGGCCAT
TTCACCTCTAAAAAATGGGATGGTTGAAGACTGGGATAGTTTCCAAGCTATTTTGGATCA
TACCTACAAAATGCATGTCAAATCAGAAGCCAGTCTCCATCCTGTTCTCATGTCAGAGGC
ACCGCGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATGTTTGAACACTACAA
CATCCCTGCCTTCTTCCTTTGCAAAACTGCAGTTTTGACAGCATTTGCTAATGGTCGTTC
TACTGGGCTGATTTTGGACAGTGGAGCCACTCATACCACGGCAATTCCAGTCCACGATGG
CTATGTCCTTCAACAAGGCATTGTGAAATCCCCTCTTGCTGGAGACTTTATTACTATGCA
GTGCAGAGAACTCTTCCAAGAAATGAATATTGAATTGGTTCCTCCATATATGATTGCATC
AAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAAGAGAGGTTGCCTCA
GGTTACGAGGTCTTGGCACAATTATATGTGTAATTGTGTTATCCAGGATTTTCAAGCTTC
GGTACTTCAAGTGTCAGATTCAACTTATGATGAACAAGTGGCTGCACAGATGCCAACTGT
TCATTATGAATTCCCCAATGGCTACGATTGTGATTTTGGTGCAGAGCGGCTAGAGATTCC
AGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAACACAATGTTAGGAGT
CAGTCATGTTGTCACCACAAGTGTTGGGATGTGTGATATTGATGTCAGACCAGGTCTCTA
TGGCAGTGTAATAGTGGCAGGAGGAAACACACTAATACAGAGTTTTACTGACAGGTTGAA
TAGAGAGCTGTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAATTGATTGCAAATAATAC
AACAGTGGAACGGAGGTTTAGCTCATGGATTGGCGGCTCCATTCTAGCCTCTTTGGGTAC
CTTTCAACAGATGTGGATTTCCAAGCAAGAATATGAAGAAGGAGGGAAGCAGTGTGTAGA
AAGAAAATGCCCTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
t220c,W74R;t375g,T125T;

a566g,K189R;a721g,N241D;

a748g,K250E;a859g,I287V
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinPurified: Not_Tested
ProteinExpressed: Protein_Confirmed
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in HR2893A
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Gaetano T. Montleione
Jessica Bearden
Northeast Structural Genomics Consortium
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ACTL6A
Symbol Nomenclature : ACTL6A
SYNONYM : ACTL6; ARPN-BETA; Arp4; BAF53A; INO80K
Designation : 53 kDa BRG1-associated factor A|BAF complex 53 kDa subunit|BAF53|BRG1-associated factor 53A|INO80 complex subunit K|actin-like protein 6A|actin-related protein 4|actin-related protein Baf53a|arpNbeta|hArpN beta
Full Nomenclature : actin-like 6A
GENEID : 86
GI : 30089999
GenBank Accession : NM_178042
HGNC : 24124
MIM : 604958
Vega : OTTHUMG00000157782
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00589647      ------------------------------------------------------------
NM_004301.3       ATGAGCGGCGGCGTGTACGGGGGAGATGAAGTTGGAGCCCTTGTTTTTGACATTGGATCC
NM_178042.2       ------------------------------------------------------------
NM_177989.2       ------------------------------------------------------------
                                                                              

HsCD00589647      ------------------------------------------------------------
NM_004301.3       TATACTGTGAGAGCTGGTTATGCTGGTGAGGACTGCCCCAAGGTGGATTTTCCTACAGCT
NM_178042.2       ------------------------------------------------------------
NM_177989.2       ------------------------------------------------------------
                                                                              

HsCD00589647      --------------CCATCACCATCACCATCACAGCCATATGGAAATAGATGGCGATAAA
NM_004301.3       ATTGGTATGGTGGTAGAAAGAGATGACGGAAGCACATTAATGGAAATAGATGGCGATAAA
NM_178042.2       ------ATGGTGGTAGAAAGAGATGACGGAAGCACATTAATGGAAATAGATGGCGATAAA
NM_177989.2       ------ATGGTGGTAGAAAGAGATGACGGAAGCACATTAATGGAAATAGATGGCGATAAA
                                . *:... ** ** .:..** . ::*********************

HsCD00589647      GGCAAACAAGGCGGTCCCACCTACTACATAGATACTAATGCTCTGCGTGTTCCGAGGGAG
NM_004301.3       GGCAAACAAGGCGGTCCCACCTACTACATAGATACTAATGCTCTGCGTGTTCCGAGGGAG
NM_178042.2       GGCAAACAAGGCGGTCCCACCTACTACATAGATACTAATGCTCTGCGTGTTCCGAGGGAG
NM_177989.2       GGCAAACAAGGCGGTCCCACCTACTACATAGATACTAATGCTCTGCGTGTTCCGAGGGAG
                  ************************************************************

HsCD00589647      AATATGGAGGCCATTTCACCTCTAAAAAATGGGATGGTTGAAGACTGGGATAGTTTCCAA
NM_004301.3       AATATGGAGGCCATTTCACCTCTAAAAAATGGGATGGTTGAAGACTGGGATAGTTTCCAA
NM_178042.2       AATATGGAGGCCATTTCACCTCTAAAAAATGGGATGGTTGAAGACTGGGATAGTTTCCAA
NM_177989.2       AATATGGAGGCCATTTCACCTCTAAAAAATGGGATGGTTGAAGACTGGGATAGTTTCCAA
                  ************************************************************

HsCD00589647      GCTATTTTGGATCATACCTACAAAATGCATGTCAAATCAGAAGCCAGTCTCCATCCTGTT
NM_004301.3       GCTATTTTGGATCATACCTACAAAATGCATGTCAAATCAGAAGCCAGTCTCCATCCTGTT
NM_178042.2       GCTATTTTGGATCATACCTACAAAATGCATGTCAAATCAGAAGCCAGTCTCCATCCTGTT
NM_177989.2       GCTATTTTGGATCATACCTACAAAATGCATGTCAAATCAGAAGCCAGTCTCCATCCTGTT
                  ************************************************************

HsCD00589647      CTCATGTCAGAGGCACCGCGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATG
NM_004301.3       CTCATGTCAGAGGCACCGTGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATG
NM_178042.2       CTCATGTCAGAGGCACCGTGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATG
NM_177989.2       CTCATGTCAGAGGCACCGTGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATG
                  ****************** *****************************************

HsCD00589647      TTTGAACACTACAACATCCCTGCCTTCTTCCTTTGCAAAACTGCAGTTTTGACAGCATTT
NM_004301.3       TTTGAACACTACAACATCCCTGCCTTCTTCCTTTGCAAAACTGCAGTTTTGACAGCATTT
NM_178042.2       TTTGAACACTACAACATCCCTGCCTTCTTCCTTTGCAAAACTGCAGTTTTGACAGCATTT
NM_177989.2       TTTGAACACTACAACATCCCTGCCTTCTTCCTTTGCAAAACTGCAGTTTTGACAGCATTT
                  ************************************************************

HsCD00589647      GCTAATGGTCGTTCTACTGGGCTGATTTTGGACAGTGGAGCCACTCATACCACGGCAATT
NM_004301.3       GCTAATGGTCGTTCTACTGGGCTGATTTTGGACAGTGGAGCCACTCATACCACTGCAATT
NM_178042.2       GCTAATGGTCGTTCTACTGGGCTGATTTTGGACAGTGGAGCCACTCATACCACTGCAATT
NM_177989.2       GCTAATGGTCGTTCTACTGGGCTGATTTTGGACAGTGGAGCCACTCATACCACTGCAATT
                  ***************************************************** ******

HsCD00589647      CCAGTCCACGATGGCTATGTCCTTCAACAAGGCATTGTGAAATCCCCTCTTGCTGGAGAC
NM_004301.3       CCAGTCCACGATGGCTATGTCCTTCAACAAGGCATTGTGAAATCCCCTCTTGCTGGAGAC
NM_178042.2       CCAGTCCACGATGGCTATGTCCTTCAACAAGGCATTGTGAAATCCCCTCTTGCTGGAGAC
NM_177989.2       CCAGTCCACGATGGCTATGTCCTTCAACAAGGCATTGTGAAATCCCCTCTTGCTGGAGAC
                  ************************************************************

HsCD00589647      TTTATTACTATGCAGTGCAGAGAACTCTTCCAAGAAATGAATATTGAATTGGTTCCTCCA
NM_004301.3       TTTATTACTATGCAGTGCAGAGAACTCTTCCAAGAAATGAATATTGAATTGGTTCCTCCA
NM_178042.2       TTTATTACTATGCAGTGCAGAGAACTCTTCCAAGAAATGAATATTGAATTGGTTCCTCCA
NM_177989.2       TTTATTACTATGCAGTGCAGAGAACTCTTCCAAGAAATGAATATTGAATTGGTTCCTCCA
                  ************************************************************

HsCD00589647      TATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAA
NM_004301.3       TATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAA
NM_178042.2       TATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAA
NM_177989.2       TATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAA
                  ************************************************************

HsCD00589647      GAGAGGTTGCCTCAGGTTACGAGGTCTTGGCACAATTATATGTGTAATTGTGTTATCCAG
NM_004301.3       GAGAAGTTGCCTCAGGTTACGAGGTCTTGGCACAATTATATGTGTAATTGTGTTATCCAG
NM_178042.2       GAGAAGTTGCCTCAGGTTACGAGGTCTTGGCACAATTATATGTGTAATTGTGTTATCCAG
NM_177989.2       GAGAAGTTGCCTCAGGTTACGAGGTCTTGGCACAATTATATGTGTAATTGTGTTATCCAG
                  ****.*******************************************************

HsCD00589647      GATTTTCAAGCTTCGGTACTTCAAGTGTCAGATTCAACTTATGATGAACAAGTGGCTGCA
NM_004301.3       GATTTTCAAGCTTCGGTACTTCAAGTGTCAGATTCAACTTATGATGAACAAGTGGCTGCA
NM_178042.2       GATTTTCAAGCTTCGGTACTTCAAGTGTCAGATTCAACTTATGATGAACAAGTGGCTGCA
NM_177989.2       GATTTTCAAGCTTCGGTACTTCAAGTGTCAGATTCAACTTATGATGAACAAGTGGCTGCA
                  ************************************************************

HsCD00589647      CAGATGCCAACTGTTCATTATGAATTCCCCAATGGCTACGATTGTGATTTTGGTGCAGAG
NM_004301.3       CAGATGCCAACTGTTCATTATGAATTCCCCAATGGCTACAATTGTGATTTTGGTGCAGAG
NM_178042.2       CAGATGCCAACTGTTCATTATGAATTCCCCAATGGCTACAATTGTGATTTTGGTGCAGAG
NM_177989.2       CAGATGCCAACTGTTCATTATGAATTCCCCAATGGCTACAATTGTGATTTTGGTGCAGAG
                  ***************************************.********************

HsCD00589647      CGGCTAGAGATTCCAGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAAC
NM_004301.3       CGGCTAAAGATTCCAGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAAC
NM_178042.2       CGGCTAAAGATTCCAGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAAC
NM_177989.2       CGGCTAAAGATTCCAGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAAC
                  ******.*****************************************************

HsCD00589647      ACAATGTTAGGAGTCAGTCATGTTGTCACCACAAGTGTTGGGATGTGTGATATTGATGTC
NM_004301.3       ACAATGTTAGGAGTCAGTCATGTTGTCACCACAAGTGTTGGGATGTGTGATATTGACATC
NM_178042.2       ACAATGTTAGGAGTCAGTCATGTTGTCACCACAAGTGTTGGGATGTGTGATATTGACATC
NM_177989.2       ACAATGTTAGGAGTCAGTCATGTTGTCACCACAAGTGTTGGGATGTGTGATATTGACATC
                  ******************************************************** .**

HsCD00589647      AGACCAGGTCTCTATGGCAGTGTAATAGTGGCAGGAGGAAACACACTAATACAGAGTTTT
NM_004301.3       AGACCAGGTCTCTATGGCAGTGTAATAGTGGCAGGAGGAAACACACTAATACAGAGTTTT
NM_178042.2       AGACCAGGTCTCTATGGCAGTGTAATAGTGGCAGGAGGAAACACACTAATACAGAGTTTT
NM_177989.2       AGACCAGGTCTCTATGGCAGTGTAATAGTGGCAGGAGGAAACACACTAATACAGAGTTTT
                  ************************************************************

HsCD00589647      ACTGACAGGTTGAATAGAGAGCTGTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAATTG
NM_004301.3       ACTGACAGGTTGAATAGAGAGCTGTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAATTG
NM_178042.2       ACTGACAGGTTGAATAGAGAGCTGTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAATTG
NM_177989.2       ACTGACAGGTTGAATAGAGAGCTGTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAATTG
                  ************************************************************

HsCD00589647      ATTGCAAATAATACAACAGTGGAACGGAGGTTTAGCTCATGGATTGGCGGCTCCATTCTA
NM_004301.3       ATTGCAAATAATACAACAGTGGAACGGAGGTTTAGCTCATGGATTGGCGGCTCCATTCTA
NM_178042.2       ATTGCAAATAATACAACAGTGGAACGGAGGTTTAGCTCATGGATTGGCGGCTCCATTCTA
NM_177989.2       ATTGCAAATAATACAACAGTGGAACGGAGGTTTAGCTCATGGATTGGCGGCTCCATTCTA
                  ************************************************************

HsCD00589647      GCCTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAGCAAGAATATGAAGAAGGAGGG
NM_004301.3       GCCTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAGCAAGAATATGAAGAAGGAGGG
NM_178042.2       GCCTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAGCAAGAATATGAAGAAGGAGGG
NM_177989.2       GCCTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAGCAAGAATATGAAGAAGGAGGG
                  ************************************************************

HsCD00589647      AAGCAGTGTGTAGAAAGAAAATGCCCTTAG
NM_004301.3       AAGCAGTGTGTAGAAAGAAAATGCCCTTGA
NM_178042.2       AAGCAGTGTGTAGAAAGAAAATGCCCTTGA
NM_177989.2       AAGCAGTGTGTAGAAAGAAAATGCCCTTGA
                  ****************************..

Pathways

NCI : C-MYC pathway
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : HATs acetylate histones

Protein

SMART domain : ACTIN : Actin
Structural Annotation Wiki : HR2893A
UniProt : O96019
HPRD : 05389

Clone

Cloning Information : 630579
Original Clone ID : HR2893A-55-429-14.33

Experimental

TargetTrack - Experimental data : HR2893A

Organism


TAX_ID : 9606
Species Specific ID: 86

Genome

Chromosome : 3
Map Location : 3q26.33
Ensembl : ENSG00000136518

Reagents

Labome : ACTL6A-antibody