DNASU Plasmid Repository • 480.965.5697 | Email

ycfS (Klebsiella pneumoniae subsp. pneumoniae MGH 78578) in pMCSG68 (Bacterial Expression)

TOP

Explanation of Terms


Gene: Gene Symbol:  ycfS
Gene Name:  putative enzyme
Sequence             
Original Clone ID: APC110663.102
Keyword: None
Species: Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Type: cDNA
Vector Name: pMCSG68               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory
Michael Endres
PSI:Biology
Midwest Center for Structural Genomics
KpCD00590757

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 882nts        
Open reading frame : 51 to 932

ATCCGCAGTTCGAAAAGGGTACCGAGAACCTGTACTTCCAATCCAATGCCAACACCTGGC
CCCTTCCCCCGCCGGGCAGCCGGCTGGTGGGTCAGAATCAGTTCCATGTGGTACAGGATG
ACGGCGGTTCGCTGGAAGCGATTGCCAAGAAGTACAATGTCGGCTTCCTGGCCCTGCTGC
AGGCCAATCCCGGAGTTGACCCCTATGTTCCGCGCGCCGGCAGCGTGCTGACCATCCCCC
TGCAGACGCTGCTGCCCGATGCGCCGCGCGAAGGGTTGGTGATTAACCTCGCCGAACTGC
GCCTCTACTATTACCCGCCGGGCAAGAATGAAGTGACCGTCTACCCAATCGGCATCGGCC
AGCTGGGTGGGACCACCATCACACCGACGATGGTCACAACCGTGTCCGACAAACGGGCCA
ATCCGACCTGGACACCTACCGCCAACATTCGCGCGCGCTACAAGGCTATGGGGATTGAGC
TGCCGGCGGTAGTGCCTGCTGGTCCTGACAATCCGATGGGCCATCATGCCATCCGCCTCG
CCGCCTATGGCGGAGTCTATCTCCTGCACGGCACCAATGCCGATTTCGGCATCGGTATGC
GCGTCAGTTCCGGCTGCATTCGTCTGCGCGATAACGATATCAAGGCGCTGTACAACACTA
TCTCGCCGGGCACGAAGGTGAACATTATCAACACGCCGATCAAGGCGTCGGTTGAGCCGG
ATGGCCGCCGTCTGGTTGAGGTCCATCAGCCGCTGTCTGAGCATATCGATGACGACCCGC
AGACCCTGCCCATTACGCTTAATGCGGCCATGACTGCGTTCAAACAGGCGCCGCAGACCG
ACGGGACGGTGATGGAGCGCGCGATGAATTACCGCTCGGGCATGCCGATTGACGTCACCC
GTCATGCTGAACCTGGACCGCAGTCGCTGTAACATTGGAAGTGGATAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinPurified: Not_Tested
ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC110663
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG68

pMCSG68 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and TEV-cleavable N-terminal 6xHis and StrepII tags; rare argU and ileX codons; ampicillin resistance in bacteria; ligation independent cloning
Comments: BglI-XbaI fragment removed from pMCSG57 and ligated into pMCSG53 digested with the same enzymes
Size (bp): 4832
Parent Vector: None
Empty Vector: EvNO00450864
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
PSI:Biology
Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 2825 3413
ligation independent cloning LIC ligation independent cloning site 204 235
promoter T7 T7 promoter 384 400
protease cleavage site TEV TEV protease cleavage site 223 243
repressor protein gene LacI Lac I gene 1437 2396
selectable marker AmpR ampicillin resistance gene 3584 4444
tRNA ileX ileX tRNA gene 983 1134
tRNA argU argU tRNA gene 467 853
tag strep N-terminal strepII tag 250 273
tag His N-terminal 6xHis tag 292 309
trxn regulatory element lac operator lac operator sequence 359 381
trxn termination sequence T7 term T7 terminator 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : ycfS
GENEID : 5341116
Locus Tag : KPN_01111
GI : 152969665
Target GenBank: None

 

Protein

SMART domain : LysM : Lysin motif
Structural Annotation Wiki : MCSG-APC110663

Clone

Cloning Information : 631924
Original Clone ID : APC110663.102

Experimental

TargetTrack - Experimental data : MCSG-APC110663

Organism


TAX_ID : 272620
Species Specific ID: 5341116