DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nHA_cHalo_DC


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJFT7_nHA_cHalo_DC              
Source: CPD
Description: In vitro expression vector with a T7 promoter and N-terminal HA and C-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Publications: None
Authors: Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa

Price:  Login for Pricing
No restriction
Special MTA: HALO



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_nHA_cHalo_DC

pJFT7_nHA_cHalo_DC in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  NAP150
Reverse:  cHaloseqR
Description: In vitro expression vector with a T7 promoter and N-terminal HA and C-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6241
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3526 4208
bacterial origin M13 Ori M13 origin 5602 6057
death cassette ccdB (BsrGI removed) ccdB death cassette (removed in plasmids containing an insert) 1801 2106
enhancer CITE CITE enhancer 17 515
primer reverse primer cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT 2387 2405
primer forward primer nap150f forward sequencing primer cccattgtatgggatctgatc 388 408
promoter T7 T7 promoter 6217 3
protease cleavage site TEV TEV protease cleavage site (removes HALO tag) 2294 2314
recombination site attR1 attR1 recombinational cloning site 567 590
recombination site attR2 attR2 recombinational cloning site 2247 2271
reporter gene LacZ LacZ alpha 6062 6130
selectable marker AmpR ampicillin resistance 4306 4965
selectable marker CmR chloramphenicol resistance (removed in plasmids containing an insert) 800 1356
ssDNA origin f1 f1 origin 5734 6040
tag HA N-terminal HA tag 531 557
tag HALO C-terminal HALO tag 2330 3214
trxn termination sequence T7 term T7 transcriptional termination 3297 3344


Species Specific ID: None
Target GenBank: None