DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMV(delta2)

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: WISP12-93
Type: No insert
Vector Name: pCMV(delta2)              
Source: Sundquist Lab
Description: Mammalian expression vector with a deletion mutant of the CMV promoter; ampicillin resistance in bacteria, neomycin resistance in mammalian cells; restriction enzyme cloning
Comments: None
Publications: None
Authors: University of Utah
Eiji Morita
Jun Arii
Wesley I. Sundquist
Devin Christensen
Jorg Votteler
EvNO00601604

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  neomycin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCMV(delta2)

pCMVdelta2 in advanced viewed

Synonyms: WISP12-93
Sequencing Primer: Forward:  pcDNAF
Reverse:  pcDNAR
Description: Mammalian expression vector with a deletion mutant of the CMV promoter; ampicillin resistance in bacteria, neomycin resistance in mammalian cells; restriction enzyme cloning
Comments: Empty vector Sundquist Lab internal database number = WISP12-93. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp): 5061
Parent Vector: Name: pCMV(WT)
Description: Vector containing the full length CMV promoter
Properties: mammalian expression, multiple cloning site
Author Name: University of Utah
Eiji Morita
Jun Arii
Wesley I. Sundquist
Devin Christensen
Jorg Votteler
Publications: PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3288 3970
primer forward pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC 649 672
primer reverse primer pcDNAR reverse 3' sequencing primer AACTAGAAGGCACAGTCGAGGCTG 414 440
promoter CMV Truncated CMV promoter 234 498
selectable marker AmpR Ampicillin resistance 4068 4727
selectable marker NeoR neomycin resistance (mammalian cells) 1769 2560
ssDNA origin f1 f1 origin 945 1251

 

Original Clone ID: WISP12-93
Species Specific ID: None
Target GenBank: None