DNASU Plasmid Repository • 480.965.5697 | Email

Light Chain (Homo sapiens) & Heavy Chain (Homo sapiens) in pCW-FABAVI-LIC

TOP

Explanation of Terms


Gene 1: Gene Symbol:  Light Chain
Gene Name:  Light Chain
Gene 2: Gene Symbol:  Heavy Chain
Gene Name:  Heavy Chain
Sequence             
Original Clone ID: anti-TDRKH-RAB-C130
Keyword: anti-TDRKH-RAB-C130 recombinant antibody fab fragment
Species: Homo sapiens
Type: cDNA
Vector Name: pCW-FABAVI-LIC               Format:  FUSION
Source: Recombinant Antibody Network
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The University of Chicago
Recombinant Antibody Network
Protein Capture Reagents Program
HsCD00604308

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 714nts         Open reading frame : 1 to 714 & 1 to 828

ATGAAATCCCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCC
ATGGCGTCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGAT
AGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTATCAA
CAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCTGGA
GTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTGACCATCAGCAGT
CTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAATCTCATTACGAACTGATCACG
TTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATCTGTCTTCATC
TTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAAT
AACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGT
AACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGC
ACCCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGCGAAGTCACC
CATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAA



ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACATCTATTCTTCTTCTATA
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATATATTTCTTCTTAT
TCTGGCTATACTTCTTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACA
TCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTAT
TATTGTGCTCGCTACTCTCTGTACGGTCATGGTTTTGACTACTGGGGTCAAGGAACCCTG
GTCACCGTCTCCTCGGCCTCCACCAAGGGTCCATCGGTCTTCCCCCTGGCACCCTCCTCC
AAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAA
CCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCT
GTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGC
TTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTCGAC
AAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACAGGAGGTTCTGGCAGCGCCGGT
GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCW-FABAVI-LIC
Synonyms: ''
Description: Recombinant antibody expression vector with Avi-tagged heavy chain; ampicillin resistance in bacteria
Comments: None
Size (bp): 6637
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, with tag/fusion/marker
Author Name: Structural Genomics Consortium
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 1612 2231
gene fragment light chain Light chain, PelB signal sequence 4796 5506
gene fragment heavy chain Heavy chain 5625 6470
promoter lac lac promoter 3171 3200
promoter lac 2 second lac promoter 4497 4520
promoter tac promoter tac promoter 4607 4635
promoter tac promoter 2 Second tac promoter 4702 4730
repressor protein gene LacI LacI 3249 4340
selectable marker AmpR Ampicillin resistance 597 1454
ssDNA origin f1 f1 origin 29 335
tag AviTag Avi tagged heavy chain 6426 6470
trxn termination sequence TrpA TrpA transcription terminator 6519 6546

 

  • Protein
  • Clone

Protein

PCRP Binder Details : anti-TDRKH-RAB-C130

Clone

Cloning Information : 664589
Original Clone ID : anti-TDRKH-RAB-C130