DNASU Plasmid Repository • 480.965.5697 | Email

GABRR2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GABRR2
Gene Name:  gamma-aminobutyric acid (GABA) A receptor, rho 2
Sequence             
Original Clone ID: ccsbBroadEn_10835
Keyword: PERFECT_MATCH
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00622810

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1398nts         Open reading frame : 1 to 1398
Reference Sequence Alignment

ATGCCTTATTTTACAAGACTCATTTTGTTCTTGTTTTGCTTGATGGTTCTCGTGGAGAGC
AGAAAACCCAAGAGGAAGCGATGGACAGGGCAGGTGGAAATGCCCAAGCCAAGTCACTTA
TATAAGAAGAACCTTGATGTGACCAAGATCCGGAAGGGAAAGCCTCAGCAGCTTCTCAGA
GTGGACGAGCACGACTTCAGCATGAGACCCGCCTTCGGAGGCCCTGCCATCCCGGTGGGC
GTGGACGTACAGGTGGAGAGCCTGGACAGCATCTCCGAGGTGGACATGGACTTCACTATG
ACCCTGTACCTGCGGCATTACTGGAAGGATGAGAGGCTAGCTTTCTCCAGCGCCAGCAAC
AAGAGCATGACCTTCGATGGCCGGCTGGTGAAGAAGATCTGGGTCCCTGATGTCTTCTTT
GTTCACTCCAAAAGATCGTTCACTCATGACACCACCACTGACAACATCATGCTGAGGGTG
TTCCCAGATGGACACGTGCTGTACAGCATGAGGATTACGGTCACTGCCATGTGCAACATG
GACTTCAGCCACTTTCCCCTGGACTCCCAGACCTGTTCTTTGGAGCTGGAGAGCTATGCC
TATACAGATGAAGATCTAATGCTGTACTGGAAGAATGGGGATGAATCCCTAAAAACAGAT
GAGAAGATCTCCTTGTCTCAGTTTCTGATTCAGAAATTTCACACAACTTCCAGGCTGGCC
TTCTACAGCAGCACTGGCTGGTACAACCGTCTGTACATTAACTTCACGTTGCGTCGCCAC
ATCTTCTTCTTCTTGCTCCAAACATATTTCCCTGCCACTCTGATGGTCATGCTGTCCTGG
GTGTCCTTCTGGATCGACCGCAGAGCTGTGCCTGCCAGAGTTTCACTGGGTATCACGACG
GTGCTGACCATGACCACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTAC
GTCAAGGCCGTGGACATCTACCTCTGGGTCAGCTTTGTGTTCGTGTTCCTCTCGGTGCTG
GAGTATGCGGCTGTCAACTACCTGACCACCGTGCAGGAGCGCAAGGAACGGAAGCTGCGG
GAGAAGTTCCCGTGCATGTGTGGAATGCTTCATTCAAAAACCATGATGCTGGATGGAAGC
TACAGTGAGTCTGAGGCCAACAGCCTGGCTGGGTACCCCAGAAGCCATATCCTGACAGAA
GAAGAAAGGCAAGACAAAATAGTGGTCCACCTGGGCCTGAGTGGTGAAGCCAACGCTGCC
AGAAAGAAGGGGCTTCTGAAGGGCCAGACGGGTTTTCGTATCTTCCAGAATACCCATGCC
ATTGACAAATACTCTAGGTTGATATTCCCTGCCTCCTACATATTTTTCAACTTAATTTAT
TGGTCAGTGTTTTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : GABRR2
Symbol Nomenclature : GABRR2
Designation : GABA(A) receptor subunit rho-2|GABA(A) receptor, rho 2|GABA(C) receptor|GABA-C receptor, rho-2 subunit|gamma-aminobutyric acid (GABA) receptor, rho 2|gamma-aminobutyric acid receptor subunit rho-2
Full Nomenclature : gamma-aminobutyric acid (GABA) A receptor, rho 2
GENEID : 2570
Locus Tag : RP1-131H7.1
HGNC : 4091
MIM : 137162
Vega : OTTHUMG00000015198
Target GenBank: BC130354.1

 

Reference Sequence Alignment

  

HsCD00622810      ATGCCTTATTTTACAAGACTCATTTTGTTCTTGTTTTGCTTGATGGTTCTCGTGGAGAGC
NM_002043.3       ATGCCTTATTTTACAAGACTCATTTTGTTCTTGTTTTGCTTGATGGTTCTCGTGGAGAGC
                  ************************************************************

HsCD00622810      AGAAAACCCAAGAGGAAGCGATGGACAGGGCAGGTGGAAATGCCCAAGCCAAGTCACTTA
NM_002043.3       AGAAAACCCAAGAGGAAGCGATGGACAGGGCAGGTGGAAATGCCCAAGCCAAGTCACTTA
                  ************************************************************

HsCD00622810      TATAAGAAGAACCTTGATGTGACCAAGATCCGGAAGGGAAAGCCTCAGCAGCTTCTCAGA
NM_002043.3       TATAAGAAGAACCTTGATGTGACCAAGATCCGGAAGGGAAAGCCTCAGCAGCTTCTCAGA
                  ************************************************************

HsCD00622810      GTGGACGAGCACGACTTCAGCATGAGACCCGCCTTCGGAGGCCCTGCCATCCCGGTGGGC
NM_002043.3       GTGGACGAGCACGACTTCAGCATGAGACCCGCCTTCGGAGGCCCTGCCATCCCGGTGGGC
                  ************************************************************

HsCD00622810      GTGGACGTACAGGTGGAGAGCCTGGACAGCATCTCCGAGGTGGACATGGACTTCACTATG
NM_002043.3       GTGGACGTACAGGTGGAGAGCCTGGACAGCATCTCCGAGGTGGACATGGACTTCACTATG
                  ************************************************************

HsCD00622810      ACCCTGTACCTGCGGCATTACTGGAAGGATGAGAGGCTAGCTTTCTCCAGCGCCAGCAAC
NM_002043.3       ACCCTGTACCTGCGGCATTACTGGAAGGATGAGAGGCTAGCTTTCTCCAGCGCCAGCAAC
                  ************************************************************

HsCD00622810      AAGAGCATGACCTTCGATGGCCGGCTGGTGAAGAAGATCTGGGTCCCTGATGTCTTCTTT
NM_002043.3       AAGAGCATGACCTTCGATGGCCGGCTGGTGAAGAAGATCTGGGTCCCTGATGTCTTCTTT
                  ************************************************************

HsCD00622810      GTTCACTCCAAAAGATCGTTCACTCATGACACCACCACTGACAACATCATGCTGAGGGTG
NM_002043.3       GTTCACTCCAAAAGATCGTTCACTCATGACACCACCACTGACAACATCATGCTGAGGGTG
                  ************************************************************

HsCD00622810      TTCCCAGATGGACACGTGCTGTACAGCATGAGGATTACGGTCACTGCCATGTGCAACATG
NM_002043.3       TTCCCAGATGGACACGTGCTGTACAGCATGAGGATTACGGTCACTGCCATGTGCAACATG
                  ************************************************************

HsCD00622810      GACTTCAGCCACTTTCCCCTGGACTCCCAGACCTGTTCTTTGGAGCTGGAGAGCTATGCC
NM_002043.3       GACTTCAGCCACTTTCCCCTGGACTCCCAGACCTGTTCTTTGGAGCTGGAGAGCTATGCC
                  ************************************************************

HsCD00622810      TATACAGATGAAGATCTAATGCTGTACTGGAAGAATGGGGATGAATCCCTAAAAACAGAT
NM_002043.3       TATACAGATGAAGATCTAATGCTGTACTGGAAGAATGGGGATGAATCCCTAAAAACAGAT
                  ************************************************************

HsCD00622810      GAGAAGATCTCCTTGTCTCAGTTTCTGATTCAGAAATTTCACACAACTTCCAGGCTGGCC
NM_002043.3       GAGAAGATCTCCTTGTCTCAGTTTCTGATTCAGAAATTTCACACAACTTCCAGGCTGGCC
                  ************************************************************

HsCD00622810      TTCTACAGCAGCACTGGCTGGTACAACCGTCTGTACATTAACTTCACGTTGCGTCGCCAC
NM_002043.3       TTCTACAGCAGCACTGGCTGGTACAACCGTCTGTACATTAACTTCACGTTGCGTCGCCAC
                  ************************************************************

HsCD00622810      ATCTTCTTCTTCTTGCTCCAAACATATTTCCCTGCCACTCTGATGGTCATGCTGTCCTGG
NM_002043.3       ATCTTCTTCTTCTTGCTCCAAACATATTTCCCTGCCACTCTGATGGTCATGCTGTCCTGG
                  ************************************************************

HsCD00622810      GTGTCCTTCTGGATCGACCGCAGAGCTGTGCCTGCCAGAGTTTCACTGGGTATCACGACG
NM_002043.3       GTGTCCTTCTGGATCGACCGCAGAGCTGTGCCTGCCAGAGTTTCACTGGGTATCACGACG
                  ************************************************************

HsCD00622810      GTGCTGACCATGACCACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTAC
NM_002043.3       GTGCTGACCATGACCACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTAC
                  ************************************************************

HsCD00622810      GTCAAGGCCGTGGACATCTACCTCTGGGTCAGCTTTGTGTTCGTGTTCCTCTCGGTGCTG
NM_002043.3       GTCAAGGCCGTGGACATCTACCTCTGGGTCAGCTTTGTGTTCGTGTTCCTCTCGGTGCTG
                  ************************************************************

HsCD00622810      GAGTATGCGGCTGTCAACTACCTGACCACCGTGCAGGAGCGCAAGGAACGGAAGCTGCGG
NM_002043.3       GAGTATGCGGCTGTCAACTACCTGACCACCGTGCAGGAGCGCAAGGAACGGAAGCTGCGG
                  ************************************************************

HsCD00622810      GAGAAGTTCCCGTGCATGTGTGGAATGCTTCATTCAAAAACCATGATGCTGGATGGAAGC
NM_002043.3       GAGAAGTTCCCGTGCATGTGTGGAATGCTTCATTCAAAAACCATGATGCTGGATGGAAGC
                  ************************************************************

HsCD00622810      TACAGTGAGTCTGAGGCCAACAGCCTGGCTGGGTACCCCAGAAGCCATATCCTGACAGAA
NM_002043.3       TACAGTGAGTCTGAGGCCAACAGCCTGGCTGGGTACCCCAGAAGCCATATCCTGACAGAA
                  ************************************************************

HsCD00622810      GAAGAAAGGCAAGACAAAATAGTGGTCCACCTGGGCCTGAGTGGTGAAGCCAACGCTGCC
NM_002043.3       GAAGAAAGGCAAGACAAAATAGTGGTCCACCTGGGCCTGAGTGGTGAAGCCAACGCTGCC
                  ************************************************************

HsCD00622810      AGAAAGAAGGGGCTTCTGAAGGGCCAGACGGGTTTTCGTATCTTCCAGAATACCCATGCC
NM_002043.3       AGAAAGAAGGGGCTTCTGAAGGGCCAGACGGGTTTTCGTATCTTCCAGAATACCCATGCC
                  ************************************************************

HsCD00622810      ATTGACAAATACTCTAGGTTGATATTCCCTGCCTCCTACATATTTTTCAACTTAATTTAT
NM_002043.3       ATTGACAAATACTCTAGGTTGATATTCCCTGCCTCCTACATATTTTTCAACTTAATTTAT
                  ************************************************************

HsCD00622810      TGGTCAGTGTTTTCCTAG
NM_002043.3       TGGTCAGTGTTTTCCTAG
                  ******************

Pathways

Reactome : GABA A (rho) receptor activation
Reactome : GABA receptor activation
Reactome : Ion channel transport
Reactome : Ligand-gated ion channel transport
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses

Protein

HPRD : 15922

Clone

Cloning Information : 671187
Original Clone ID : ccsbBroadEn_10835

Organism


TAX_ID : 9606
Species Specific ID: 2570

Genome

Chromosome : 6
Map Location : 6q15
Ensembl : ENSG00000111886