DNASU Plasmid Repository • 480.965.5697 | Email

SLC10A6 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)


Explanation of Terms

Gene: Gene Symbol:  SLC10A6
Gene Name:  solute carrier family 10 (sodium/bile acid cotransporter), member 6
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1131nts         Open reading frame : 1 to 1131


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
5' Linker Sequence: None
3' Linker Sequence: None


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome



Gene Symbol : SLC10A6
Symbol Nomenclature : SLC10A6
Designation : sodium-dependent organic anion transporter|solute carrier family 10 (sodium/bile acid cotransporter family), member 6|solute carrier family 10 member 6
Full Nomenclature : solute carrier family 10 (sodium/bile acid cotransporter), member 6
GENEID : 345274
HGNC : 30603
MIM : 613366
Vega : OTTHUMG00000130596
Target GenBank: None



Reactome : Bile acid and bile salt metabolism
Reactome : Bile salt and organic anion SLC transporters
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Recycling of bile acids and salts
Reactome : SLC-mediated transmembrane transport
Reactome : Transmembrane transport of small molecules
Reactome : Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds


HPRD : 11593


Cloning Information : 674178


TAX_ID : 9606
Species Specific ID: 345274


Chromosome : 4
Map Location : 4q21.3
Ensembl : ENSG00000145283