DNASU Plasmid Repository • 480.965.5697 | Email

asd (Francisella tularensis Schu 4) in pDEST17 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  asd
Gene Name:  aspartate semialdehyde dehydrogenase
Sequence             
Original Clone ID: FLH232967.01X
Keyword: None
Species: Francisella tularensis Schu 4
Type: cDNA
Vector Name: pDEST17               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
FtCD00063210

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1095nts         Open reading frame : 1 to 1095

ATGCTTAAAGTTGGTTTTATTGGTTGGCGCGGAATGGTCGGCTCAGTTTTAATGTCTCGT
ATGATCGAATCAAAAGATTTTGATTGTATTTTGCCAACGTTTTTTTCGACATCTCAGGTA
GGGCAGCTGCCAACAGGTTTTATGCAACAATATGGAGCGTTACAAGATGCCTATAGTATC
GACCAACTAAGTAGTATGGATATACTTCTAAGTTGCCAAGGTGGTGAATATACCAAAGAA
ATACACCACAAATTAAGAGAAGCCGGCTGGCAAGGTTTCTGGATAGACGCTGCATCGACA
CTACGCTTAGACAAAGATAGTACTCTAGTTCTAGACCCTCTAAATCACGATCAAATAATT
AATGCTATTGATAATGGTAAAAAAGATTTTATCGGTAGTAATTGTACTGTTAGTCTAATG
TCACTAGCTATAGCTGGACTACTCAAAGAAGATCTTGTTGAATGGGTTAACTCTAGTACT
TATCAAGCAATTTCAGGAGCGGGTGCCGCAGCAATGCAAGAACTACTTCAACAAACAAGC
CTTTTAAGCAAAATTGATAATAGAGATGAAGATATTCTAATTAGAGAAAAAATTCTCAGA
GAATTATCAAAAGACTCATCAAAAATCCCTCAACAAAAAACTGTACAAACTTTGGCTTAT
AATCTATTACCTTGGATAGATGTTGGTATGCCTAGTGGACAAACAAAAGAAGAGTACAAA
GCAGCTACAGAACTTAATAAAATTCTAGATACTAAAAAAACAATCCCTGTCGATGGTATA
TGTGTCAGAGTACCAAGTCTAAGATCACACTCTCAAGCATTAACAGTCAAACTTAGACAG
AAATTAACAATTGAAGAAATTAAGCAAAAAATATCTCAAGGTAATGAATGGGTTAAAGTA
ATAGATAATAACAAAGAAGATACTTTAAAATACCTAACACCTCAAGCTAATTCAGGAACT
CTTGATATTGCTATAGGTCGTATCAAATCATCGTTATTAGCTGATGATATATTTCATTGT
TTCACAGTAGGTGATCAGCTATTATGGGGAGCTGCTGAGCCCCTTAGAAGAGTTTTAAAT
ATTATTAAAATATAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1095
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDEST17

pDEST17 in advanced viewed

Synonyms: pDEST-17
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 promoter and ribosome binding site (RBS), adds N-term 6xHis tag; amp resistance; recombinational cloning.
Comments: None
Size (bp): 6354
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, in vitro transcription, recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start ATG initiation ATG (before 6xHis tag) 101 103
bacterial origin pBR322 ori pBR322 origin of replication 3575 4248
gene fragment ROP ROP ORF 4619 4810
negative selection marker ccdB ccdB death cassette ONLY in Non-Recombined (NO INSERT) form 1374 1679
promoter bla bla promoter (prokaryotic promoter from bla gene) 2471 2569
promoter T7 T7 promoter 21 40
recombination site attR1 attR1 recombination site 140 264
recombination site attR2 attR2 recombination site 1720 1844
ribosome binding site RBS Ribosome binding site 86 92
selectable marker CmR chlorampenicol resistance gene ONLY In Non-Recombined (NO INSERT) form 373 1032
selectable marker AmpR ampicillin resistance gene (bla) 2570 3430
tag His 6xHis tag (N-terminal to insert) 113 130
trxn termination sequence T7 term T7 transcription termination sequence 1855 1983

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Reagents

Gene

Target GenBank: YP_169468

 

Clone

Cloning Information : 232967
HIP Master Clone ID : 181865
Original Clone ID : FLH232967.01X

Organism


Species Specific ID: FTT0425c

Reagents

Labome : asd-cDNA