DNASU Plasmid Repository • 480.965.5697 | Email

H2AFX (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)


Explanation of Terms

Gene: Gene Symbol:  H2AFX
Gene Name:  H2A histone family, member X
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 429nts         Open reading frame : 1 to 429


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome



Gene Symbol : H2AFX
Symbol Nomenclature : H2AFX
Designation : H2AX histone|histone H2A.x|histone H2AX
Full Nomenclature : H2A histone family, member X
GENEID : 3014
GenBank Accession : BC011694
HGNC : 4739
MIM : 601772
Vega : OTTHUMG00000166196
Target GenBank: BC011694



NCI : ATM pathway
NCI : Fanconi anemia pathway
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Amyloids
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : Condensation of Prophase Chromosomes
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Deposition of new CENPA-containing nucleosomes at the centromere
Reactome : Disease
Reactome : Double-Strand Break Repair
Reactome : Epigenetic regulation of gene expression
Reactome : Gene Expression
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : M Phase
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Meiotic synapsis
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleosome assembly
Reactome : Oxidative Stress Induced Senescence
Reactome : PRC2 methylates histones and DNA
Reactome : Packaging Of Telomere Ends
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Opening
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : SIRT1 negatively regulates rRNA Expression
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : Telomere Maintenance
Reactome : Transcription
Reactome : formation of the beta-catenin:TCF transactivating complex
WikiPathway : DNA damage response
WikiPathway : Proteasome Degradation
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR


HPRD : 03465


Cloning Information : 711659
IMAGE ID : 3139343


TAX_ID : 9606
Species Specific ID: 3014


Chromosome : 11
Map Location : 11q23.3
Ensembl : ENSG00000188486