DNASU Plasmid Repository • 480.965.5697 | Email

TNFRSF10B (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TNFRSF10B
Gene Name:  tumor necrosis factor receptor superfamily, member 10b
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH058016.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000007

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1236nts         Open reading frame : 1 to 1236
Reference Sequence Alignment

ATGGAACAACGGGGACAGAACGCCCCGGCCGCTTCGGGGGCCCGGAAAAGGCACGGCCCA
GGACCCAGGGAGGCGCGGGGAGCCAGGCCTGGGCTCCGGGTCCCCAAGACCCTTGTGCTC
GTTGTCGCCGCGGTCCTGCTGTTGGTCTCAGCTGAGTCTGCTCTGATCACCCAACAAGAC
CTAGCTCCCCAGCAGAGAGCGGCCCCACAACAAAAGAGGTCCAGCCCCTCAGAGGGATTG
TGTCCACCTGGACACCATATCTCAGAAGACGGTAGAGATTGCATCTCCTGCAAATATGGA
CAGGACTATAGCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGAT
TCAGGTGAAGTGGAGCTAAGTCCCTGCACCACGACCAGAAACACAGTGTGTCAGTGCGAA
GAAGGCACCTTCCGGGAAGAAGATTCTCCTGAGATGTGCCGGAAGTGCCGCACAGGGTGT
CCCAGAGGGATGGTCAAGGTCGGTGATTGTACACCCTGGAGTGACATCGAATGTGTCCAC
AAAGAATCAGGCATCATCATAGGAGTCACAGTTGCAGCCGTAGTCTTGATTGTGGCTGTG
TTTGTTTGCAAGTCTTTACTGTGGAAGAAAGTCCTTCCTTACCTGAAAGGCATCTGCTCA
GGTGGTGGTGGGGACCCTGAGCGTGTGGACAGAAGCTCACAACGACCTGGGGCTGAGGAC
AATGTCCTCAATGAGATCGTGAGTATCTTGCAGCCCACCCAGGTCCCTGAGCAGGAAATG
GAAGTCCAGGAGCCAGCAGAGCCAACAGGTGTCAACATGTTGTCCCCCGGGGAGTCAGAG
CATCTGCTGGAACCGGCAGAAGCTGAAAGGTCTCAGAGGAGGAGGCTGCTGGTTCCAGCA
AATGAAGGTGATCCCACTGAGACTCTGAGACAGTGCTTCGATGACTTTGCAGACTTGGTG
CCCTTTGACTCCTGGGAGCCGCTCATGAGGAAGTTGGGCCTCATGGACAATGAGATAAAG
GTGGCTAAAGCTGAGGCAGCGGGCCACAGGGACACCTTGTACACGATGCTGATAAAGTGG
GTCAACAAAACCGGGCGAGATGCCTCTGTCCACACCCTGCTGGATGCCTTGGAGACGCTG
GGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATG
TATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1236
Start on reference sequence 1
Mutations:
None
Discrepancy:
c95t,P32L
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TNFRSF10B
Symbol Nomenclature : TNFRSF10B
SYNONYM : CD262; DR5; KILLER; KILLER/DR5; TRAIL-R2; TRAILR2; TRICK2; TRICK2A; TRICK2B; TRICKB; ZTNFR9
Designation : Fas-like protein|TNF receptor superfamily member 10b|TNF-related apoptosis-inducing ligand receptor 2|apoptosis inducing protein TRICK2A/2B|apoptosis inducing receptor TRAIL-R2|cytotoxic TRAIL receptor-2|death domain containing receptor for TRAIL/Apo-2L|death receptor 5|p53-regulated DNA damage-inducible cell death receptor(killer)|tumor necrosis factor receptor superfamily member 10B|tumor necrosis factor receptor-like protein ZTNFR9
Full Nomenclature : tumor necrosis factor receptor superfamily, member 10b
GENEID : 8795
Locus Tag : UNQ160/PRO186
GI : 60812389
GenBank Accession : AY893173
HGNC : 11905
MIM : 603612
Vega : OTTHUMG00000097826
Target GenBank: NM_003842

 

Reference Sequence Alignment

  

HsCD00000007      ATGGAACAACGGGGACAGAACGCCCCGGCCGCTTCGGGGGCCCGGAAAAGGCACGGCCCA
NM_003842.4       ATGGAACAACGGGGACAGAACGCCCCGGCCGCTTCGGGGGCCCGGAAAAGGCACGGCCCA
NM_147187.2       ATGGAACAACGGGGACAGAACGCCCCGGCCGCTTCGGGGGCCCGGAAAAGGCACGGCCCA
                  ************************************************************

HsCD00000007      GGACCCAGGGAGGCGCGGGGAGCCAGGCCTGGGCTCCGGGTCCCCAAGACCCTTGTGCTC
NM_003842.4       GGACCCAGGGAGGCGCGGGGAGCCAGGCCTGGGCCCCGGGTCCCCAAGACCCTTGTGCTC
NM_147187.2       GGACCCAGGGAGGCGCGGGGAGCCAGGCCTGGGCCCCGGGTCCCCAAGACCCTTGTGCTC
                  ********************************** *************************

HsCD00000007      GTTGTCGCCGCGGTCCTGCTGTTGGTCTCAGCTGAGTCTGCTCTGATCACCCAACAAGAC
NM_003842.4       GTTGTCGCCGCGGTCCTGCTGTTGGTCTCAGCTGAGTCTGCTCTGATCACCCAACAAGAC
NM_147187.2       GTTGTCGCCGCGGTCCTGCTGTTGGTCTCAGCTGAGTCTGCTCTGATCACCCAACAAGAC
                  ************************************************************

HsCD00000007      CTAGCTCCCCAGCAGAGAGCGGCCCCACAACAAAAGAGGTCCAGCCCCTCAGAGGGATTG
NM_003842.4       CTAGCTCCCCAGCAGAGAGCGGCCCCACAACAAAAGAGGTCCAGCCCCTCAGAGGGATTG
NM_147187.2       CTAGCTCCCCAGCAGAGAGCGGCCCCACAACAAAAGAGGTCCAGCCCCTCAGAGGGATTG
                  ************************************************************

HsCD00000007      TGTCCACCTGGACACCATATCTCAGAAGACGGTAGAGATTGCATCTCCTGCAAATATGGA
NM_003842.4       TGTCCACCTGGACACCATATCTCAGAAGACGGTAGAGATTGCATCTCCTGCAAATATGGA
NM_147187.2       TGTCCACCTGGACACCATATCTCAGAAGACGGTAGAGATTGCATCTCCTGCAAATATGGA
                  ************************************************************

HsCD00000007      CAGGACTATAGCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGAT
NM_003842.4       CAGGACTATAGCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGAT
NM_147187.2       CAGGACTATAGCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGAT
                  ************************************************************

HsCD00000007      TCAGGTGAAGTGGAGCTAAGTCCCTGCACCACGACCAGAAACACAGTGTGTCAGTGCGAA
NM_003842.4       TCAGGTGAAGTGGAGCTAAGTCCCTGCACCACGACCAGAAACACAGTGTGTCAGTGCGAA
NM_147187.2       TCAGGTGAAGTGGAGCTAAGTCCCTGCACCACGACCAGAAACACAGTGTGTCAGTGCGAA
                  ************************************************************

HsCD00000007      GAAGGCACCTTCCGGGAAGAAGATTCTCCTGAGATGTGCCGGAAGTGCCGCACAGGGTGT
NM_003842.4       GAAGGCACCTTCCGGGAAGAAGATTCTCCTGAGATGTGCCGGAAGTGCCGCACAGGGTGT
NM_147187.2       GAAGGCACCTTCCGGGAAGAAGATTCTCCTGAGATGTGCCGGAAGTGCCGCACAGGGTGT
                  ************************************************************

HsCD00000007      CCCAGAGGGATGGTCAAGGTCGGTGATTGTACACCCTGGAGTGACATCGAATGTGTCCAC
NM_003842.4       CCCAGAGGGATGGTCAAGGTCGGTGATTGTACACCCTGGAGTGACATCGAATGTGTCCAC
NM_147187.2       CCCAGAGGGATGGTCAAGGTCGGTGATTGTACACCCTGGAGTGACATCGAATGTGTCCAC
                  ************************************************************

HsCD00000007      AAAGAATCAG--------------------------------------------------
NM_003842.4       AAAGAATCAGGTACAAAGCACAGTGGGGAAGTCCCAGCTGTGGAGGAGACGGTGACCTCC
NM_147187.2       AAAGAATCAG--------------------------------------------------
                  **********                                                  

HsCD00000007      -------------------------------------GCATCATCATAGGAGTCACAGTT
NM_003842.4       AGCCCAGGGACTCCTGCCTCTCCCTGTTCTCTCTCAGGCATCATCATAGGAGTCACAGTT
NM_147187.2       -------------------------------------GCATCATCATAGGAGTCACAGTT
                                                       ***********************

HsCD00000007      GCAGCCGTAGTCTTGATTGTGGCTGTGTTTGTTTGCAAGTCTTTACTGTGGAAGAAAGTC
NM_003842.4       GCAGCCGTAGTCTTGATTGTGGCTGTGTTTGTTTGCAAGTCTTTACTGTGGAAGAAAGTC
NM_147187.2       GCAGCCGTAGTCTTGATTGTGGCTGTGTTTGTTTGCAAGTCTTTACTGTGGAAGAAAGTC
                  ************************************************************

HsCD00000007      CTTCCTTACCTGAAAGGCATCTGCTCAGGTGGTGGTGGGGACCCTGAGCGTGTGGACAGA
NM_003842.4       CTTCCTTACCTGAAAGGCATCTGCTCAGGTGGTGGTGGGGACCCTGAGCGTGTGGACAGA
NM_147187.2       CTTCCTTACCTGAAAGGCATCTGCTCAGGTGGTGGTGGGGACCCTGAGCGTGTGGACAGA
                  ************************************************************

HsCD00000007      AGCTCACAACGACCTGGGGCTGAGGACAATGTCCTCAATGAGATCGTGAGTATCTTGCAG
NM_003842.4       AGCTCACAACGACCTGGGGCTGAGGACAATGTCCTCAATGAGATCGTGAGTATCTTGCAG
NM_147187.2       AGCTCACAACGACCTGGGGCTGAGGACAATGTCCTCAATGAGATCGTGAGTATCTTGCAG
                  ************************************************************

HsCD00000007      CCCACCCAGGTCCCTGAGCAGGAAATGGAAGTCCAGGAGCCAGCAGAGCCAACAGGTGTC
NM_003842.4       CCCACCCAGGTCCCTGAGCAGGAAATGGAAGTCCAGGAGCCAGCAGAGCCAACAGGTGTC
NM_147187.2       CCCACCCAGGTCCCTGAGCAGGAAATGGAAGTCCAGGAGCCAGCAGAGCCAACAGGTGTC
                  ************************************************************

HsCD00000007      AACATGTTGTCCCCCGGGGAGTCAGAGCATCTGCTGGAACCGGCAGAAGCTGAAAGGTCT
NM_003842.4       AACATGTTGTCCCCCGGGGAGTCAGAGCATCTGCTGGAACCGGCAGAAGCTGAAAGGTCT
NM_147187.2       AACATGTTGTCCCCCGGGGAGTCAGAGCATCTGCTGGAACCGGCAGAAGCTGAAAGGTCT
                  ************************************************************

HsCD00000007      CAGAGGAGGAGGCTGCTGGTTCCAGCAAATGAAGGTGATCCCACTGAGACTCTGAGACAG
NM_003842.4       CAGAGGAGGAGGCTGCTGGTTCCAGCAAATGAAGGTGATCCCACTGAGACTCTGAGACAG
NM_147187.2       CAGAGGAGGAGGCTGCTGGTTCCAGCAAATGAAGGTGATCCCACTGAGACTCTGAGACAG
                  ************************************************************

HsCD00000007      TGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGCTCATGAGGAAG
NM_003842.4       TGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGCTCATGAGGAAG
NM_147187.2       TGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGCTCATGAGGAAG
                  ************************************************************

HsCD00000007      TTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGGGCCACAGGGAC
NM_003842.4       TTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGGGCCACAGGGAC
NM_147187.2       TTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGGGCCACAGGGAC
                  ************************************************************

HsCD00000007      ACCTTGTACACGATGCTGATAAAGTGGGTCAACAAAACCGGGCGAGATGCCTCTGTCCAC
NM_003842.4       ACCTTGTACACGATGCTGATAAAGTGGGTCAACAAAACCGGGCGAGATGCCTCTGTCCAC
NM_147187.2       ACCTTGTACACGATGCTGATAAAGTGGGTCAACAAAACCGGGCGAGATGCCTCTGTCCAC
                  ************************************************************

HsCD00000007      ACCCTGCTGGATGCCTTGGAGACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGAC
NM_003842.4       ACCCTGCTGGATGCCTTGGAGACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGAC
NM_147187.2       ACCCTGCTGGATGCCTTGGAGACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGAC
                  ************************************************************

HsCD00000007      CACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCC
NM_003842.4       CACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCC
NM_147187.2       CACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCC
                  ************************************************************

HsCD00000007      TAG
NM_003842.4       TAA
NM_147187.2       TAA
                  **.

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Direct p53 effectors
NCI : TRAIL signaling pathway
Panther : Apoptosis signaling pathway
Panther : p53 pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : Regulation by c-FLIP
Reactome : TRAIL signaling
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : DNA damage response
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Squamous cell TarBase
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 58016
HIP Master Clone ID : 36686
Original Clone ID : FLH058016.01X

Organism


TAX_ID : 9606
Species Specific ID: 8795

Genome

Chromosome : 8
Map Location : 8p22-p21
Ensembl : ENSG00000120889

Reagents

Labome : DR5-antibody