DNASU Plasmid Repository • 480.965.5697 | Email

chrd (Xenopus laevis) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  chrd
Gene Name:  chordin
Sequence             
Original Clone ID: None
Keyword: None
Species: Xenopus laevis
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: Xenopus Gene Collection
Description: None
Comments: The ORFeome Collaboration, REVERSE_PRIMER: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAACTCCATGGAGTCCTTG, FORWARD_PRIMER: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGTGTCCCCCCATCCTACTT, XGC Collection: IRBH
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Cancer Systems Biology
Cincinnati Children's Hospital Medical Center
MRC National Institute for Medical Research
University of Virginia School of Medicine
Aaron Zorn
David E. Hill
Michael J. Gilchrist
Todd Stukenberg
Xenopus Gene Collection
XlCD00710294

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2820nts        
Open reading frame : 1 to 2820

ATGCAGTGTCCCCCCATCCTACTTGTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCT
CGCCCAAAGGTTTTCTTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCCAAGACTCCA
GCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCATGGCATCCAGATCTT
GGGGAACCATTCGGAGTTATGCACTGCGTACTATGCTATTGTGAGCCGCAGCGAAGTCGT
CGGGGAAAACCATCTGGTAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCC
TCCTGTGCTAACCCTATACTGCTCCCAGGACATTGCTGCAAGACTTGTCCCAAAGCTCCT
CCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGACGGATTTGAGTATTTTCAAGAGAAG
GATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCTGATGATGTCGCTGTGGAGGAG
AGTCGTTCAGAATATGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACC
AGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCCAATTTGCTCTTCTCAATCACT
TATAAATGGATAGACAGACTTTCCAGAATCCGTTTCTCCGATCTTGACGGTTCTGTGCTG
TTTGAACACCCAGTGCACAGAATGGGATCCCCACGGGATGACACTATCTGTGGCATTTGG
AGGTCCCTTAATCGGTCCACTCTACGTCTTCTCCGAATGGGTCACATTCTTGTATCTCTG
GTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTA
TTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGA
GGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTC
AGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAG
AACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAG
GTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATT
TCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAA
TCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACT
GGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATT
CAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGA
AAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGG
GGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTC
CTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTG
CTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTT
GTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCAC
TGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTG
AACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACAC
AAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGAC
CTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTG
AATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGA
GTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAG
CGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGG
GCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAG
AAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTC
CATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAA
AAACCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAG
GCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATT
TGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTT
TCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGAGGAG
CGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTT
GGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAG
ATGAAATGTGTTACATGCACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGT
ACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGAT
GCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTT
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attP1 attP recombination site 1 present in empty vector with death cassette, replaced by attL1 in recombined form with gene of interest or other insert 569 652
recombination site attP2 attP recombination site 2 present in empty vector with death cassette, replaced by attL2 in recombined form with gene of interest or other insert 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Clone
  • Organism

Gene

Target GenBank: BC077767

 

Clone

Cloning Information : 763230
XGC Gene Symbol : LOC398045
Xenbase ORF Name : chrd ORF1

Organism


Species Specific ID: 398045