DNASU Plasmid Repository • 480.965.5697 | Email

XRCC6 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  XRCC6
Gene Name:  X-ray repair complementing defective repair in Chinese hamster cells 6
Sequence             
Original Clone ID: FLH258100.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00074058

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 684nts         Open reading frame : 1 to 684
Reference Sequence Alignment

ATGTCAGGGTGGGAGTCATATTACAAAACCGAGGTTGCAGCATTGTGCAGATACACACCC
CGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTGGATGAC
CAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCTGATGAT
AAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGCAAGATG
AAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAACCCCGTG
CTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCGGAACAA
GCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCCTTGGTG
GATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTTACCAAG
AGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCAGAAGAG
GAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATGCTGAAA
GAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTGGAAGCC
CTCACCAAGCACTTCCAGGACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 705
Start on reference sequence 22
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : Mach1 T1-R
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : XRCC6
Symbol Nomenclature : XRCC6
SYNONYM : CTC75; CTCBF; G22P1; KU70; ML8; TLAA
Designation : 5'-dRP lyase Ku70|5'-deoxyribose-5-phosphate lyase Ku70|70 kDa subunit of Ku antigen|ATP-dependent DNA helicase 2 subunit 1|ATP-dependent DNA helicase II 70 kDa subunit|ATP-dependent DNA helicase II, 70 kDa subunit|CTC box binding factor 75 kDa subunit|CTC box-binding factor 75 kDa subunit|DNA repair protein XRCC6|Ku autoantigen p70 subunit|Ku autoantigen, 70kDa|X-ray repair cross-complementing protein 6|lupus Ku autoantigen protein p70|thyroid autoantigen 70kD (Ku antigen)|thyroid autoantigen 70kDa (Ku antigen)|thyroid-lupus autoantigen p70
Full Nomenclature : X-ray repair complementing defective repair in Chinese hamster cells 6
GENEID : 2547
Locus Tag : CTA-216E10.7
GI : 109451317
GenBank Accession : CU013089
HGNC : 4055
MIM : 152690
Vega : OTTHUMG00000151190
Target GenBank: CR456492

 

Reference Sequence Alignment

  

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      ATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAA
NM_001288978.1      -------------------------------------ATGAAGAAGCAGAGGAAGAACAA
NM_001469.4         ATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAA
NM_001288976.1      ATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAA
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      GAAGAGAACCTTGAAGCAAGTG--------------------------------------
NM_001288978.1      GAAGAGAACCTTGAAGCAAGTG--------------------------------------
NM_001469.4         GAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTT
NM_001288976.1      GAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      ------------------------------------------------------------
NM_001288978.1      ------------------------------------------------------------
NM_001469.4         TTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTT
NM_001288976.1      TTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      -------------------------GAGACTATAAATATTCAGGAAGAGATAGTTTGATT
NM_001288978.1      ---------------TGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGA
NM_001469.4         GACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGA
NM_001288976.1      GACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGA
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      TTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCT
NM_001288978.1      GATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAA
NM_001469.4         GATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAA
NM_001288976.1      GATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAA
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      TTTGACATGAGCATCCAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGAC
NM_001288978.1      AATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGAC
NM_001469.4         AATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGAC
NM_001288976.1      AATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGAC
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      CAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGCCACGGATCTGAC
NM_001288978.1      CAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGCCACGGATCTGAC
NM_001469.4         CAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGCCACGGATCTGAC
NM_001288976.1      CAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGCCACGGATCTGAC
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      TACTCACTCAGTGAAGTGCTGTGGGTCTGTGCCAACCTCTTTAGTGATGTCCAATTCAAG
NM_001288978.1      TACTCACTCAGTGAAGTGCTGTGGGTCTGTGCCAACCTCTTTAGTGATGTCCAATTCAAG
NM_001469.4         TACTCACTCAGTGAAGTGCTGTGGGTCTGTGCCAACCTCTTTAGTGATGTCCAATTCAAG
NM_001288976.1      TACTCACTCAGTGAAGTGCTGTGGGTCTGTGCCAACCTCTTTAGTGATGTCCAATTCAAG
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      ATGAGTCATAAGAGGATCATGCTGTTCACCAATGAAGACAACCCCCATGGCAATGACAGT
NM_001288978.1      ATGAGTCATAAGAGGATCATGCTGTTCACCAATGAAGACAACCCCCATGGCAATGACAGT
NM_001469.4         ATGAGTCATAAGAGGATCATGCTGTTCACCAATGAAGACAACCCCCATGGCAATGACAGT
NM_001288976.1      ATGAGTCATAAGAGGATCATGCTGTTCACCAATGAAGACAACCCCCATGGCAATGACAGT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      GCCAAAGCCAGCCGGGCCAGGACCAAAGCCGGTGATCTCCGAGATACAGGCATCTTCCTT
NM_001288978.1      GCCAAAGCCAGCCGGGCCAGGACCAAAGCCGGTGATCTCCGAGATACAGGCATCTTCCTT
NM_001469.4         GCCAAAGCCAGCCGGGCCAGGACCAAAGCCGGTGATCTCCGAGATACAGGCATCTTCCTT
NM_001288976.1      GCCAAAGCCAGCCGGGCCAGGACCAAAGCCGGTGATCTCCGAGATACAGGCATCTTCCTT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      GACTTGATGCACCTGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATC
NM_001288978.1      GACTTGATGCACCTGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATC
NM_001469.4         GACTTGATGCACCTGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATC
NM_001288976.1      GACTTGATGCACCTGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATC
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      ATCAGCATAGCAGAGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAA
NM_001288978.1      ATCAGCATAGCAGAGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAA
NM_001469.4         ATCAGCATAGCAGAGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAA
NM_001288976.1      ATCAGCATAGCAGAGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAA
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      GACCTGTTGCGGAAGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAG
NM_001288978.1      GACCTGTTGCGGAAGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAG
NM_001469.4         GACCTGTTGCGGAAGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAG
NM_001288976.1      GACCTGTTGCGGAAGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAG
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      CTGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCT
NM_001288978.1      CTGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCT
NM_001469.4         CTGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCT
NM_001288976.1      CTGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      CTCAAGCCTCCTCCAATAAAGCTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACC
NM_001288978.1      CTCAAGCCTCCTCCAATAAAGCTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACC
NM_001469.4         CTCAAGCCTCCTCCAATAAAGCTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACC
NM_001288976.1      CTCAAGCCTCCTCCAATAAAGCTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACC
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      CGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAG
NM_001288978.1      CGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAG
NM_001469.4         CGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAG
NM_001288976.1      CGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAG
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      ATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTT
NM_001288978.1      ATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTT
NM_001469.4         ATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTT
NM_001288976.1      ATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      GATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCAT
NM_001288978.1      GATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCAT
NM_001469.4         GATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCAT
NM_001288976.1      GATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCAT
                                                                                

HsCD00074058        ------------------------------------------------------------
NM_001288977.1      TACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTGGGAGCTCAACC
NM_001288978.1      TACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTGGGAGCTCAACC
NM_001469.4         TACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTGGGAGCTCAACC
NM_001288976.1      TACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTGGGAGCTCAACC
                                                                                

HsCD00074058        ------ATGTCAGGGTGGGAGTCATATTACAAAACCGAGGTTGCAGCATTGTGCAGATAC
NM_001288977.1      CTGTTCAGTGCTCTGCTCATCAAGTGTCTGGAGAAGGAGGTTGCAGCATTGTGCAGATAC
NM_001288978.1      CTGTTCAGTGCTCTGCTCATCAAGTGTCTGGAGAAGGAGGTTGCAGCATTGTGCAGATAC
NM_001469.4         CTGTTCAGTGCTCTGCTCATCAAGTGTCTGGAGAAGGAGGTTGCAGCATTGTGCAGATAC
NM_001288976.1      CTGTTCAGTGCTCTGCTCATCAAGTGTCTGGAGAAGGAGGTTGCAGCATTGTGCAGATAC
                          *   *:  *   .: :..*.* : .*.*. ************************

HsCD00074058        ACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTG
NM_001288977.1      ACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTG
NM_001288978.1      ACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTG
NM_001469.4         ACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTG
NM_001288976.1      ACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTG
                    ************************************************************

HsCD00074058        GATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCT
NM_001288977.1      GATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCT
NM_001288978.1      GATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCT
NM_001469.4         GATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCT
NM_001288976.1      GATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCT
                    ************************************************************

HsCD00074058        GATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGC
NM_001288977.1      GATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGC
NM_001288978.1      GATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGC
NM_001469.4         GATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGC
NM_001288976.1      GATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGC
                    ************************************************************

HsCD00074058        AAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAAC
NM_001288977.1      AAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAAC
NM_001288978.1      AAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAAC
NM_001469.4         AAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAAC
NM_001288976.1      AAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAAC
                    ************************************************************

HsCD00074058        CCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCG
NM_001288977.1      CCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCG
NM_001288978.1      CCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCG
NM_001469.4         CCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCG
NM_001288976.1      CCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCG
                    ************************************************************

HsCD00074058        GAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCC
NM_001288977.1      GAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCC
NM_001288978.1      GAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCC
NM_001469.4         GAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCC
NM_001288976.1      GAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCC
                    ************************************************************

HsCD00074058        TTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTT
NM_001288977.1      TTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTT
NM_001288978.1      TTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTT
NM_001469.4         TTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTT
NM_001288976.1      TTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTT
                    ************************************************************

HsCD00074058        ACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCA
NM_001288977.1      ACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCA
NM_001288978.1      ACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCA
NM_001469.4         ACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCA
NM_001288976.1      ACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCA
                    ************************************************************

HsCD00074058        GAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATG
NM_001288977.1      GAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATG
NM_001288978.1      GAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATG
NM_001469.4         GAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATG
NM_001288976.1      GAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATG
                    ************************************************************

HsCD00074058        CTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTG
NM_001288977.1      CTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTG
NM_001288978.1      CTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTG
NM_001469.4         CTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTG
NM_001288976.1      CTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTG
                    ************************************************************

HsCD00074058        GAAGCCCTCACCAAGCACTTCCAGGACTGA
NM_001288977.1      GAAGCCCTCACCAAGCACTTCCAGGACTGA
NM_001288978.1      GAAGCCCTCACCAAGCACTTCCAGGACTGA
NM_001469.4         GAAGCCCTCACCAAGCACTTCCAGGACTGA
NM_001288976.1      GAAGCCCTCACCAAGCACTTCCAGGACTGA
                    ******************************

Pathways

NCI : BARD1 signaling events
NCI : Coregulation of Androgen receptor activity
NCI : DNA-PK pathway in nonhomologous end joining
NCI : Regulation of Telomerase
NCI : Signaling events mediated by HDAC Class III
Reactome : 2-LTR circle formation
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : Disease
Reactome : Double-Strand Break Repair
Reactome : Early Phase of HIV Life Cycle
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integration of provirus
Reactome : Nonhomologous End-joining (NHEJ)
Reactome : Processing of DNA ends prior to end rejoining
Reactome : STING mediated induction of host immune responses
WikiPathway : Non-homologous end joining

Clone

Cloning Information : 258100
HIP Master Clone ID : 194716
IMAGE ID : 100000348
Original Clone ID : FLH258100.01X

Organism


TAX_ID : 9606
Species Specific ID: 2547

Genome

Chromosome : 22
Map Location : 22q13.2
Ensembl : ENSG00000196419

Reagents

Labome : Ku70-antibody