DNASU Plasmid Repository • 480.965.5697 | Email

PIK3C2A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3C2A
Gene Name:  phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Sequence             
Original Clone ID: FLH258629.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00074096

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 5061nts         Open reading frame : 1 to 5061
Reference Sequence Alignment

ATGGCTCAGATATTTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
ACAGGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
TCAGATTCCCAAAAGAGAGCATTAGATATCGATGTAGAAAAGCTCACCCAAGCTGAACTT
GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
GCACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTACCGTCCAGTAGTCAGT
ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCGCAAAGAAACATATGCGGAGAA
AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
ACTGCGGCAACATACTTGAGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 5061
Start on reference sequence 1
Mutations:
None
Discrepancy:
t44c,F15S; a64g,R22G;
 a255g; t270c;
 a601g,T201A; t645c;
 g2387t,C796F; g2396a,R799K;
 g2765t,G922V; c3385a,L1129M;
 t4348a,W1450R; t4391a,V1464D
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3C2A
Symbol Nomenclature : PIK3C2A
SYNONYM : CPK; PI3-K-C2(ALPHA); PI3-K-C2A
Designation : C2-containing phosphatidylinositol kinase|PI3K-C2-alpha|PI3K-C2alpha|phosphatidylinositol 4-phosphate 3-kinase C2 domain-containing subunit alpha|phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing subunit alpha|phosphoinositide 3-kinase-C2-alpha|phosphoinositide-3-kinase, class 2, alpha polypeptide|ptdIns-3-kinase C2 subunit alpha
Full Nomenclature : phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
GENEID : 5286
HGNC : 8971
MIM : 603601
Vega : OTTHUMG00000166036
Target GenBank: NM_002645.1

 

Reference Sequence Alignment

  

HsCD00074096        ATGGCTCAGATATTTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
XM_005252977.1      ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
NM_002645.2         ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ACAGGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
XM_005252977.1      ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
NM_002645.2         ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
XM_005252977.1      AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
NM_002645.2         AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
XM_005252977.1      ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
NM_002645.2         ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        TCAGATTCCCAAAAGAGAGCATTAGATATCGATGTAGAAAAGCTCACCCAAGCTGAACTT
XM_005252977.1      TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
NM_002645.2         TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
XM_005252977.1      GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
NM_002645.2         GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
XM_005252977.1      CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
NM_002645.2         CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
XM_005252977.1      CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
NM_002645.2         CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
XM_005252977.1      ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
NM_002645.2         ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
XM_005252977.1      TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
NM_002645.2         TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        GCACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTACCGTCCAGTAGTCAGT
XM_005252977.1      ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
NM_002645.2         ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
XM_005252977.1      ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
NM_002645.2         ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
XM_005252977.1      AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
NM_002645.2         AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
XM_005252977.1      AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
NM_002645.2         AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
XM_005252977.1      GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
NM_002645.2         GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
XM_005252977.1      AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
NM_002645.2         AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
XM_005252977.1      AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
NM_002645.2         AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
XM_005252977.1      ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
NM_002645.2         ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
XM_005252977.1      ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
NM_002645.2         ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00074096        ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
XM_005252977.1      ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
NM_002645.2         ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
XM_005252980.1      ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
                    ************************************************************

HsCD00074096        CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCGCAAAGAAACATATGCGGAGAA
XM_005252977.1      CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
NM_002645.2         CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
XM_005252980.1      CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
                    **************************************.*********************

HsCD00074096        AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
XM_005252977.1      AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
NM_002645.2         AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
XM_005252980.1      AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
                    ************************************************************

HsCD00074096        TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
XM_005252977.1      TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
NM_002645.2         TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
XM_005252980.1      TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
                    ************************************************************

HsCD00074096        GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
XM_005252977.1      GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
NM_002645.2         GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
XM_005252980.1      GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
                    ************************************************************

HsCD00074096        CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
XM_005252977.1      CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
NM_002645.2         CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
XM_005252980.1      CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
                    ************************************************************

HsCD00074096        ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
XM_005252977.1      ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
NM_002645.2         ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
XM_005252980.1      ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
                    ************************************************************

HsCD00074096        GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
XM_005252977.1      GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
NM_002645.2         GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
XM_005252980.1      GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
                    ************************************************************

HsCD00074096        TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
XM_005252977.1      TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
NM_002645.2         TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
XM_005252980.1      TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
                    ************************************************************

HsCD00074096        GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
XM_005252977.1      GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
NM_002645.2         GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
XM_005252980.1      GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
                    ************************************************************

HsCD00074096        GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
XM_005252977.1      GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
NM_002645.2         GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
XM_005252980.1      GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
                    ************************************************************

HsCD00074096        AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
XM_005252977.1      AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
NM_002645.2         AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
XM_005252980.1      AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
                    ************************************************************

HsCD00074096        TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
XM_005252977.1      TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
NM_002645.2         TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
XM_005252980.1      TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
                    ************************************************************

HsCD00074096        GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
XM_005252977.1      GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
NM_002645.2         GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
XM_005252980.1      GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
                    ************************************************************

HsCD00074096        AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
XM_005252977.1      AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
NM_002645.2         AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
XM_005252980.1      AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
                    ************************************************************

HsCD00074096        ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
XM_005252977.1      ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
NM_002645.2         ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
XM_005252980.1      ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
                    ************************************************************

HsCD00074096        GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
XM_005252977.1      GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
NM_002645.2         GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
XM_005252980.1      GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
                    ************************************************************

HsCD00074096        TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
XM_005252977.1      TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
NM_002645.2         TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
XM_005252980.1      TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
                    ************************************************************

HsCD00074096        TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
XM_005252977.1      TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
NM_002645.2         TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
XM_005252980.1      TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
                    ************************************************************

HsCD00074096        CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
XM_005252977.1      CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
NM_002645.2         CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
XM_005252980.1      CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
                    ************************************************************

HsCD00074096        CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
XM_005252977.1      CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
NM_002645.2         CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
XM_005252980.1      CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
                    ************************************************************

HsCD00074096        TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
XM_005252977.1      TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
NM_002645.2         TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
XM_005252980.1      TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
                    ************************************************************

HsCD00074096        CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
XM_005252977.1      CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
NM_002645.2         CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
XM_005252980.1      CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
                    ************************************************************

HsCD00074096        CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
XM_005252977.1      CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
NM_002645.2         CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
XM_005252980.1      CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
                    ************************************************************

HsCD00074096        CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
XM_005252977.1      CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
NM_002645.2         CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
XM_005252980.1      CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
                    ************************************************************

HsCD00074096        AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
XM_005252977.1      AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
NM_002645.2         AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
XM_005252980.1      AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
                    ************************************************************

HsCD00074096        TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
XM_005252977.1      TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
NM_002645.2         TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
XM_005252980.1      TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
                    ************************************************************

HsCD00074096        TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
XM_005252977.1      TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
NM_002645.2         TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
XM_005252980.1      TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
                    ************************************************************

HsCD00074096        ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
XM_005252977.1      ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
NM_002645.2         ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
XM_005252980.1      ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
                    ************************************************************

HsCD00074096        ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
XM_005252977.1      ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
NM_002645.2         ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
XM_005252980.1      ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
                    ************************************************************

HsCD00074096        GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
XM_005252977.1      GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
NM_002645.2         GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
XM_005252980.1      GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
                    ************************************************************

HsCD00074096        TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
XM_005252977.1      TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
NM_002645.2         TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
XM_005252980.1      TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
                    ************************************************************

HsCD00074096        GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
XM_005252977.1      GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
NM_002645.2         GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
XM_005252980.1      GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
                    ************************************************************

HsCD00074096        CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
XM_005252977.1      CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
NM_002645.2         CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
XM_005252980.1      CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
                    ************************************************************

HsCD00074096        GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
XM_005252977.1      GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
NM_002645.2         GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
XM_005252980.1      GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
                    ************************************************************

HsCD00074096        CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
XM_005252977.1      CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
NM_002645.2         CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
XM_005252980.1      CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
                    ************************************************************

HsCD00074096        GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
XM_005252977.1      GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
NM_002645.2         GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
XM_005252980.1      GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
                    ************************************************************

HsCD00074096        GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
XM_005252977.1      GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
NM_002645.2         GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
XM_005252980.1      GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
                    ************************************************************

HsCD00074096        GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
XM_005252977.1      GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
NM_002645.2         GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
XM_005252980.1      GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
                    ************************************************************

HsCD00074096        CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
XM_005252977.1      CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
NM_002645.2         CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
XM_005252980.1      CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
                    ************************************************************

HsCD00074096        CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
XM_005252977.1      CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
NM_002645.2         CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
XM_005252980.1      CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
                    ************************************************************

HsCD00074096        GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
XM_005252977.1      GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
NM_002645.2         GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
XM_005252980.1      GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
                    ************************************************************

HsCD00074096        TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
XM_005252977.1      TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
NM_002645.2         TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
XM_005252980.1      TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
                    ************************************************************

HsCD00074096        GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
XM_005252977.1      GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
NM_002645.2         GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
XM_005252980.1      GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
                    ************************************************************

HsCD00074096        ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
XM_005252977.1      ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
NM_002645.2         ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
XM_005252980.1      ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
                    ************************************************************

HsCD00074096        AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
XM_005252977.1      AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
NM_002645.2         AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
XM_005252980.1      AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
                    ************************************************************

HsCD00074096        GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
XM_005252977.1      GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
NM_002645.2         GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
XM_005252980.1      GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
                    ************************************************************

HsCD00074096        AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
XM_005252977.1      AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
NM_002645.2         AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
XM_005252980.1      AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
                    ************************************************************

HsCD00074096        GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
XM_005252977.1      GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
NM_002645.2         GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
XM_005252980.1      GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
                    ************************************************************

HsCD00074096        CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
XM_005252977.1      CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
NM_002645.2         CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
XM_005252980.1      CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
                    ************************************************************

HsCD00074096        AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
XM_005252977.1      AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
NM_002645.2         AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
XM_005252980.1      AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
                    ************************************************************

HsCD00074096        CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
XM_005252977.1      CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
NM_002645.2         CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
XM_005252980.1      CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
                    ************************************************************

HsCD00074096        GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
XM_005252977.1      GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
NM_002645.2         GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
XM_005252980.1      GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
                    ************************************************************

HsCD00074096        CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
XM_005252977.1      CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
NM_002645.2         CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
XM_005252980.1      CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
                    ************************************************************

HsCD00074096        CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
XM_005252977.1      CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
NM_002645.2         CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
XM_005252980.1      CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
                    ************************************************************

HsCD00074096        AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
XM_005252977.1      AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
NM_002645.2         AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
XM_005252980.1      AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
                    ************************************************************

HsCD00074096        GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
XM_005252977.1      GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
NM_002645.2         GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
XM_005252980.1      GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
                    ************************************************************

HsCD00074096        GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
XM_005252977.1      GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
NM_002645.2         GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
XM_005252980.1      GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
                    ************************************************************

HsCD00074096        GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
XM_005252977.1      GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
NM_002645.2         GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
XM_005252980.1      GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
                    ************************************************************

HsCD00074096        GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
XM_005252977.1      GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
NM_002645.2         GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
XM_005252980.1      GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
                    ************************************************************

HsCD00074096        ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
XM_005252977.1      ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
NM_002645.2         ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
XM_005252980.1      ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
                    ************************************************************

HsCD00074096        CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
XM_005252977.1      CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
NM_002645.2         CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
XM_005252980.1      CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
                    ************************************************************

HsCD00074096        CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
XM_005252977.1      CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
NM_002645.2         CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
XM_005252980.1      CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
                    ************************************************************

HsCD00074096        GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
XM_005252977.1      GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
NM_002645.2         GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
XM_005252980.1      GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
                    ************************************************************

HsCD00074096        GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
XM_005252977.1      GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
NM_002645.2         GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
XM_005252980.1      GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
                    ************************************************************

HsCD00074096        ACTGCGGCAACATACTTGAGA
XM_005252977.1      ACTGCGGCAACATACTTGTAA
NM_002645.2         ACTGCGGCAACATACTTGTAA
XM_005252980.1      ACTGCGGCAACATACTTGTAA
                    ******************:.*

Pathways

NCI : Integrins in angiogenesis
Panther : Angiogenesis
Panther : Axon guidance mediated by netrin
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Clathrin derived vesicle budding
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PI Metabolism
Reactome : Phospholipid metabolism
Reactome : Synthesis of PIPs at the Golgi membrane
Reactome : Synthesis of PIPs at the early endosome membrane
Reactome : Synthesis of PIPs at the late endosome membrane
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : trans-Golgi Network Vesicle Budding
WikiPathway : Insulin Signaling
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 258629
HIP Master Clone ID : 195152
Original Clone ID : FLH258629.01L

Organism


TAX_ID : 9606
Species Specific ID: 5286

Genome

Chromosome : 11
Map Location : 11p15.5-p14
Ensembl : ENSG00000011405

Reagents

Labome : PIK3C2A-antibody