DNASU Plasmid Repository • 480.965.5697 | Email

ARF1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARF1
Gene Name:  ADP-ribosylation factor 1
Sequence             
Original Clone ID: FLH213774.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074196

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 546nts        
Open reading frame : 1 to 546
Reference Sequence Alignment

ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATC
CTCATGGTGGGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGT
GAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAAC
ATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCAC
TACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTG
AACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTC
CTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACA
GACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCC
ACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAG
AAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 610
Start on reference sequence 65
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARF1
Symbol Nomenclature : ARF1
Full Nomenclature : ADP-ribosylation factor 1
GENEID : 375
HGNC : 652
MIM : 103180
Vega : OTTHUMG00000037595
Target GenBank: BC009247

 

Reference Sequence Alignment

  

HsCD00074196        ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATC
NM_001024226.1      ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATC
NM_001658.3         ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATC
XM_005268856.1      ATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATC
NM_001024227.1      ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATC
NM_001659.2         ATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATC
NM_001024228.1      ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATC
                    ***** ** ***** * .*****  *****.**** :**** **.**.**.*********

HsCD00074196        CTCATGGTGGGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGT
NM_001024226.1      CTCATGGTGGGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGT
NM_001658.3         CTCATGGTGGGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGT
XM_005268856.1      CTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTCGGG
NM_001024227.1      CTCATGGTGGGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGT
NM_001659.2         CTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTGGGG
NM_001024228.1      CTCATGGTGGGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGT
                    ** ***************** *****.******** *****.******** **.** ** 

HsCD00074196        GAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAAC
NM_001024226.1      GAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAAC
NM_001658.3         GAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAAC
XM_005268856.1      GAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAAC
NM_001024227.1      GAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAAC
NM_001659.2         GAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAAC
NM_001024228.1      GAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAAC
                    ******** ******** ** *****:** ***** *****.**.******** ******

HsCD00074196        ATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCAC
NM_001024226.1      ATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCAC
NM_001658.3         ATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCAC
XM_005268856.1      ATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACAC
NM_001024227.1      ATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCAC
NM_001659.2         ATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACAC
NM_001024228.1      ATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCAC
                    ******** **:******** ******************** **.***** ***.*.***

HsCD00074196        TACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTG
NM_001024226.1      TACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTG
NM_001658.3         TACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTG
XM_005268856.1      TACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTA
NM_001024227.1      TACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTG
NM_001659.2         TACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTA
NM_001024228.1      TACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTG
                    **************.*****  ****.** ***** *********** .*.*****:**.

HsCD00074196        AACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTC
NM_001024226.1      AACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTC
NM_001658.3         AACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTC
XM_005268856.1      AATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTA
NM_001024227.1      AACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTC
NM_001659.2         AATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTA
NM_001024228.1      AACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTC
                    ** ******** **.***** *****.******** ***********************.

HsCD00074196        CTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACA
NM_001024226.1      CTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACA
NM_001658.3         CTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACA
XM_005268856.1      CTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACA
NM_001024227.1      CTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACA
NM_001659.2         CTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACA
NM_001024228.1      CTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACA
                    ***** ** ** **.*****.***** ** ** ** ** ***** ** ** *********

HsCD00074196        GACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCC
NM_001024226.1      GACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCC
NM_001658.3         GACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCC
XM_005268856.1      GACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCC
NM_001024227.1      GACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCC
NM_001659.2         GACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCC
NM_001024228.1      GACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCC
                    *********** ***** **.**:** ***.* *********************** ***

HsCD00074196        ACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAG
NM_001024226.1      ACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAG
NM_001658.3         ACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAG
XM_005268856.1      ACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAG
NM_001024227.1      ACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAG
NM_001659.2         ACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAG
NM_001024228.1      ACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAG
                    ******** ******** ** *****.************ ***********...***.**

HsCD00074196        AAGTAG
NM_001024226.1      AAGTGA
NM_001658.3         AAGTGA
XM_005268856.1      AAGTGA
NM_001024227.1      AAGTGA
NM_001659.2         AAGTGA
NM_001024228.1      AAGTGA
                    ****..

Pathways

NCI : Arf1 pathway
NCI : Arf6 downstream pathway
NCI : Class I PI3K signaling events
NCI : Signaling events mediated by VEGFR1 and VEGFR2
Panther : Huntington disease
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Clathrin derived vesicle budding
Reactome : COPI Mediated Transport
Reactome : Disease
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Golgi to ER Retrograde Transport
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Lysosome Vesicle Biogenesis
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : MHC class II antigen presentation
Reactome : Nef Mediated CD4 Down-regulation
Reactome : Nef-mediates down modulation of cell surface receptors by recruiting them to clathrin adapters
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Synthesis of PIPs at the Golgi membrane
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
Reactome : trans-Golgi Network Vesicle Budding
WikiPathway : Cell cycle
WikiPathway : Insulin Signaling

Clone

Cloning Information : 213774
HIP Master Clone ID : 26703
Original Clone ID : FLH213774.01X

Organism


TAX_ID : 9606
Species Specific ID: 375

Genome

Chromosome : 1
Map Location : 1q42
Ensembl : ENSG00000143761

Reagents

Labome : ARF1-antibody