DNASU Plasmid Repository • 480.965.5697 | Email

PTPN6 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  PTPN6
Gene Name:  protein tyrosine phosphatase, non-receptor type 6
Original Clone ID: FLH213780.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1794nts         Open reading frame : 1 to 1794
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1938
Start on reference sequence 145
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PTPN6
Symbol Nomenclature : PTPN6
Designation : hematopoietic cell phosphatase|hematopoietic cell protein-tyrosine phosphatase|protein-tyrosine phosphatase 1C|protein-tyrosine phosphatase SHP-1|tyrosine-protein phosphatase non-receptor type 6
Full Nomenclature : protein tyrosine phosphatase, non-receptor type 6
GENEID : 5777
HGNC : 9658
MIM : 176883
Vega : OTTHUMG00000168518
Target GenBank: BC007667


Reference Sequence Alignment


                        :     .***********************************************




























                  ..*::**** .*.   .:*.**.* ** . .* :.... .:***. .**. ... :**.*

HsCD00074202      AAGCAGCGGTCAGCAG--------------------------------------------
NM_080548.4       AAGCAGCGGTCAGCAG--------------------------------------------
NM_002831.5       AAGCAGCGGTCAGCAG--------------------------------------------
                  ...*:** .  . *.*                                            

HsCD00074202      ------------------------ACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGT
NM_080548.4       ------------------------ACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGT
NM_002831.5       ------------------------ACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGT
                                          ********.* .  :* *. :.*** .* *  ***:

HsCD00074202      AG-------------------
NM_080548.4       GA-------------------
NM_002831.5       GA-------------------


NCI : BCR signaling pathway
NCI : CXCR4-mediated signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPO signaling pathway
NCI : IL4-mediated signaling events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : B cell activation
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : PD-1 signaling
Reactome : PECAM1 interactions
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Regulation of KIT signaling
Reactome : Signal Transduction
Reactome : Signal regulatory protein (SIRP) family interactions
Reactome : Signaling by Interleukins
Reactome : Signaling by SCF-KIT
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway


Cloning Information : 213780
HIP Master Clone ID : 28152
Original Clone ID : FLH213780.01X


TAX_ID : 9606
Species Specific ID: 5777


Chromosome : 12
Map Location : 12p13
Ensembl : ENSG00000111679


Labome : SHP-1-antibody