DNASU Plasmid Repository • 480.965.5697 | Email

LDLR (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LDLR
Gene Name:  low density lipoprotein receptor
Sequence             
Original Clone ID: FLH213791.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074209

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2583nts         Open reading frame : 1 to 2583
Reference Sequence Alignment

ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
ACTGCAGTGGGCGACAGATGTGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
GGCGTCTCTTCCTATGACACCGTCATCAGCAGGGACATCCAGGCCCCCGACGGGCTGGCT
GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
AAACTTCACTCCATCTCAAGCATCGATGTCAATGGGGGCAACCGGAAGACCATCTTGGAG
GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTCCTCTTCCACAACCTCACCCAG
CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
ACAACCACCCGGCCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2653
Start on reference sequence 71
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LDLR
Symbol Nomenclature : LDLR
SYNONYM : FH; FHC; LDLCQ2
Designation : LDL receptor|low-density lipoprotein receptor|low-density lipoprotein receptor class A domain-containing protein 3
Full Nomenclature : low density lipoprotein receptor
GENEID : 3949
HGNC : 6547
MIM : 606945
Vega : OTTHUMG00000171935
Target GenBank: BC014514

 

Reference Sequence Alignment

  

HsCD00074209        ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_000527.4         ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_001195799.1      ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_001195798.1      ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
                    ************************************************************

HsCD00074209        ACTGCAGTGGGCGACAGATGTGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_000527.4         ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_001195799.1      ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_001195798.1      ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
                    ******************** ***************************************

HsCD00074209        TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_000527.4         TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_001195799.1      TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_001195798.1      TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
                    ************************************************************

HsCD00074209        GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
NM_000527.4         GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
NM_001195799.1      GAGACGT-----------------------------------------------------
NM_001195798.1      GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
                    *******                                                     

HsCD00074209        CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
NM_000527.4         CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
NM_001195799.1      ------------------------------------------------------------
NM_001195798.1      CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
                                                                                

HsCD00074209        GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_000527.4         GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_001195799.1      ----------GCTCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_001195798.1      GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
                              *  ***********************************************

HsCD00074209        TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_000527.4         TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_001195799.1      TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_001195798.1      TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
                    ************************************************************

HsCD00074209        GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_000527.4         GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_001195799.1      GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_001195798.1      GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
                    ************************************************************

HsCD00074209        ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_000527.4         ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_001195799.1      ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_001195798.1      ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
                    ************************************************************

HsCD00074209        CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_000527.4         CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_001195799.1      CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_001195798.1      CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
                    ************************************************************

HsCD00074209        GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_000527.4         GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_001195799.1      GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_001195798.1      GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
                    ************************************************************

HsCD00074209        GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_000527.4         GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_001195799.1      GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_001195798.1      GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
                    ************************************************************

HsCD00074209        TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_000527.4         TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_001195799.1      TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_001195798.1      TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
                    ************************************************************

HsCD00074209        TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_000527.4         TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_001195799.1      TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_001195798.1      TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
                    ************************************************************

HsCD00074209        AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_000527.4         AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_001195799.1      AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_001195798.1      AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
                    ************************************************************

HsCD00074209        GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_000527.4         GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_001195799.1      GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_001195798.1      GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
                    ************************************************************

HsCD00074209        AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_000527.4         AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_001195799.1      AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_001195798.1      AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
                    ************************************************************

HsCD00074209        CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_000527.4         CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_001195799.1      CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_001195798.1      CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
                    ************************************************************

HsCD00074209        CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_000527.4         CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_001195799.1      CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_001195798.1      CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
                    ************************************************************

HsCD00074209        GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_000527.4         GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_001195799.1      GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_001195798.1      GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
                    ************************************************************

HsCD00074209        CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_000527.4         CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_001195799.1      CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_001195798.1      CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
                    ************************************************************

HsCD00074209        AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_000527.4         AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_001195799.1      AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_001195798.1      AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
                    ************************************************************

HsCD00074209        ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_000527.4         ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_001195799.1      ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_001195798.1      ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
                    ************************************************************

HsCD00074209        GGCGTCTCTTCCTATGACACCGTCATCAGCAGGGACATCCAGGCCCCCGACGGGCTGGCT
NM_000527.4         GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
NM_001195799.1      GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
NM_001195798.1      GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
                    ********************************.***************************

HsCD00074209        GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_000527.4         GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_001195799.1      GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_001195798.1      GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
                    ************************************************************

HsCD00074209        GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_000527.4         GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_001195799.1      GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_001195798.1      GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
                    ************************************************************

HsCD00074209        GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_000527.4         GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_001195799.1      GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_001195798.1      GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
                    ************************************************************

HsCD00074209        AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_000527.4         AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_001195799.1      AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_001195798.1      AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
                    ************************************************************

HsCD00074209        CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_000527.4         CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_001195799.1      CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_001195798.1      CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
                    ************************************************************

HsCD00074209        AAACTTCACTCCATCTCAAGCATCGATGTCAATGGGGGCAACCGGAAGACCATCTTGGAG
NM_000527.4         AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
NM_001195799.1      AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
NM_001195798.1      AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
                    ******************************** ***************************

HsCD00074209        GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_000527.4         GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_001195799.1      GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_001195798.1      GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
                    ************************************************************

HsCD00074209        ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_000527.4         ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_001195799.1      ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_001195798.1      ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
                    ************************************************************

HsCD00074209        TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTCCTCTTCCACAACCTCACCCAG
NM_000527.4         TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
NM_001195799.1      TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
NM_001195798.1      TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
                    ************************************** *********************

HsCD00074209        CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_000527.4         CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_001195799.1      CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_001195798.1      CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
                    ************************************************************

HsCD00074209        TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_000527.4         TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_001195799.1      TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_001195798.1      TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
                    ************************************************************

HsCD00074209        GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_000527.4         GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_001195799.1      GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_001195798.1      GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
                    ************************************************************

HsCD00074209        ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_000527.4         ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_001195799.1      ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_001195798.1      ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
                    ************************************************************

HsCD00074209        ACAACCACCCGGCCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_000527.4         ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_001195799.1      ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_001195798.1      ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
                    ***********.************************************************

HsCD00074209        ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_000527.4         ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_001195799.1      ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_001195798.1      ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
                    ************************************************************

HsCD00074209        GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_000527.4         GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_001195799.1      GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_001195798.1      GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
                    ************************************************************

HsCD00074209        TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_000527.4         TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_001195799.1      TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_001195798.1      TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
                    ************************************************************

HsCD00074209        ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_000527.4         ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_001195799.1      ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_001195798.1      ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
                    ************************************************************

HsCD00074209        AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_000527.4         AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_001195799.1      AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_001195798.1      AACCAGGACGGCTACAGCTACCCCTCGATGGTCAG------TCTGGAGGATGACGTGGCG
                    **************************** . : *       *******************

HsCD00074209        TAG
NM_000527.4         TGA
NM_001195799.1      TGA
NM_001195798.1      TGA
                    *..

Pathways

Reactome : Chylomicron-mediated lipid transport
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : LDL-mediated lipid transport
Reactome : Lipid digestion, mobilization, and transport
Reactome : Lipoprotein metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Retinoid metabolism and transport
Reactome : Signal Transduction
Reactome : Visual phototransduction
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Folate Metabolism
WikiPathway : SREBF and miR33 in cholesterol and lipid homeostasis
WikiPathway : Selenium Pathway
WikiPathway : Statin Pathway
WikiPathway : Vitamin B12 Metabolism
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : LY : Low-density lipoprotein-receptor YWTD domain
SMART domain : LDLa : Low-density lipoprotein receptor domain class A
SMART domain : EGF : Epidermal growth factor-like domain.
SMART domain : EGF_CA : Calcium-binding EGF-like domain
UniProt : B4DJZ8
UniProt : B4DII3
UniProt : Q59FQ1
UniProt : B4DR00
UniProt : P01130
UniProt : B4DTQ3
HPRD : 06091

Clone

Cloning Information : 213791
HIP Master Clone ID : 53217
Original Clone ID : FLH213791.01X

Organism


TAX_ID : 9606
Species Specific ID: 3949

Genome

Chromosome : 19
Map Location : 19p13.2
Ensembl : ENSG00000130164

Reagents

Labome : LDLR-antibody