DNASU Plasmid Repository • 480.965.5697 | Email

YWHAE (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAE
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
Sequence             
Original Clone ID: FLH212915.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074360

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 768nts         Open reading frame : 1 to 768
Reference Sequence Alignment

ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 855
Start on reference sequence 88
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAE
Symbol Nomenclature : YWHAE
SYNONYM : 14-3-3E; HEL2; KCIP-1; MDCR; MDS
Designation : 14-3-3 epsilon|14-3-3 protein epsilon|epididymis luminal protein 2|mitochondrial import stimulation factor L subunit|protein kinase C inhibitor protein-1|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide|tyrosine 3/tryptophan 5 -monooxygenase activation protein, epsilon polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
GENEID : 7531
HGNC : 12851
MIM : 605066
Vega : OTTHUMG00000134316
Target GenBank: BC001440

 

Reference Sequence Alignment

  

HsCD00074360        ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
XM_005256784.1      ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
NM_006761.4         ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
                    ************************************************************

HsCD00074360        GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
XM_005256784.1      GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
NM_006761.4         GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
                    ************************************************************

HsCD00074360        GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
XM_005256784.1      GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
NM_006761.4         GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
                    ************************************************************

HsCD00074360        AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
XM_005256784.1      AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
NM_006761.4         AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
                    ************************************************************

HsCD00074360        ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
XM_005256784.1      ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
NM_006761.4         ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
                    ************************************************************

HsCD00074360        CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
XM_005256784.1      CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
NM_006761.4         CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
                    ************************************************************

HsCD00074360        TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
XM_005256784.1      TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
NM_006761.4         TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
                    ************************************************************

HsCD00074360        AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
XM_005256784.1      AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
NM_006761.4         AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
                    ************************************************************

HsCD00074360        ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
XM_005256784.1      ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
NM_006761.4         ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
                    ************************************************************

HsCD00074360        TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
XM_005256784.1      TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
NM_006761.4         TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
                    ************************************************************

HsCD00074360        GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
XM_005256784.1      GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
NM_006761.4         GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
                    ************************************************************

HsCD00074360        ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
XM_005256784.1      ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGATTCC
NM_006761.4         ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
                    *******************************************************.* ..

HsCD00074360        GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTAG
XM_005256784.1      TAA---------------------------------------------
NM_006761.4         GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGA
                     *.                                             

Pathways

NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : IGF1 pathway
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : PDGFR-beta signaling pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class II
NCI : TGF-beta receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
NCI : p75(NTR)-mediated signaling
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Apoptosis
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Centrosome maturation
Reactome : G2/M Transition
Reactome : HSF1 activation
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : Membrane Trafficking
Reactome : Mitotic G2-G2/M phases
Reactome : NADE modulates death signalling
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Signal Transduction
Reactome : Signaling by Hippo
Reactome : Signalling by NGF
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : P62258
HPRD : 05457

Clone

Cloning Information : 212915
HIP Master Clone ID : 86934
Original Clone ID : FLH212915.01X

Organism


TAX_ID : 9606
Species Specific ID: 7531

Genome

Chromosome : 17
Map Location : 17p13.3
Ensembl : ENSG00000108953