DNASU Plasmid Repository • 480.965.5697 | Email

IL8 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IL8
Gene Name:  interleukin 8
Sequence             
Original Clone ID: FLH213122.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074526

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 300nts         Open reading frame : 1 to 300
Reference Sequence Alignment

ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 340
Start on reference sequence 41
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IL8
Symbol Nomenclature : IL8
SYNONYM : CXCL8; GCP-1; GCP1; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1
Designation : T-cell chemotactic factor|alveolar macrophage chemotactic factor I|beta endothelial cell-derived neutrophil activating peptide|beta-thromboglobulin-like protein|chemokine (C-X-C motif) ligand 8|emoctakin|granulocyte chemotactic protein 1|interleukin-8|lung giant cell carcinoma-derived chemotactic protein|lymphocyte derived neutrophil activating peptide|monocyte-derived neutrophil chemotactic factor|monocyte-derived neutrophil-activating peptide|neutrophil-activating peptide 1|small inducible cytokine subfamily B, member 8|tumor necrosis factor-induced gene 1
Full Nomenclature : interleukin 8
GENEID : 3576
HGNC : 6025
MIM : 146930
Vega : OTTHUMG00000151316
Target GenBank: BC013615

 

Reference Sequence Alignment

  

HsCD00074526      ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
NM_000584.3       ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
                  ************************************************************

HsCD00074526      GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
NM_000584.3       GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
                  ************************************************************

HsCD00074526      TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
NM_000584.3       TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
                  ************************************************************

HsCD00074526      TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
NM_000584.3       TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
                  ************************************************************

HsCD00074526      AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAG
NM_000584.3       AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA
                  ***********************************************************.

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Glucocorticoid receptor regulatory network
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : IL8-mediated signaling events
NCI : LPA receptor mediated events
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interleukin signaling pathway
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Senescence and Autophagy
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 213122
HIP Master Clone ID : 87068
Original Clone ID : FLH213122.01X

Organism


TAX_ID : 9606
Species Specific ID: 3576

Genome

Chromosome : 4
Map Location : 4q13-q21
Ensembl : ENSG00000169429

Reagents

Labome : IL-8-antibody