DNASU Plasmid Repository • 480.965.5697 | Email

DDC (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DDC
Gene Name:  dopa decarboxylase (aromatic L-amino acid decarboxylase)
Sequence             
Original Clone ID: FLH213299.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074654

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1443nts         Open reading frame : 1 to 1443
Reference Sequence Alignment

ATGAACGCAAGTGAATTCCGAAGGAGAGGGAAGGAGATGGTGGATTACGTGGCCAACTAC
ATGGAAGGCATTGAGGGACGCCAGGTCTACCCTGACGTGGAGCCCGGGTACCTGCGGCCG
CTGATCCCTGCCGCTGCCCCTCAGGAGCCAGACACGTTTGAGGACATCATCAACGACGTT
GAGAAGATAATCATGCCTGGGGTGACGCACTGGCACAGCCCCTACTTCTTCGCCTACTTC
CCCACTGCCAGCTCGTACCCGGCCATGCTTGCGGACATGCTGTGCGGGGCCATTGGCTGC
ATCGGCTTCTCCTGGGCGGCAAGCCCAGCATGCACAGAGCTGGAGACTGTGATGATGGAC
TGGCTCGGGAAGATGCTGGAACTACCAAAGGCATTTTTGAATGAGAAAGCTGGAGAAGGG
GGAGGAGTGATCCAGGGAAGTGCCAGTGAAGCCACCCTGGTGGCCCTGCTGGCCGCTCGG
ACCAAAGTGATCCATCGGCTGCAGGCAGCGTCCCCAGAGCTCACACAGGCCGCTATCATG
GAGAAGCTGGTGGCTTACTCATCCGATCAGGCACACTCCTCAGTGGAAAGAGCTGGGTTA
ATTGGTGGAGTGAAATTAAAAGCCATCCCCTCAGATGGCAACTTCGCCATGCGTGCGTCT
GCCCTGCAGGAAGCCCTGGAGAGAGACAAAGCGGCTGGCCTGATTCCTTTCTTTATGGTT
GCCACCCTGGGGACCACAACATGCTGCTCCTTTGACAATCTCTTAGAAGTCGGTCCTATC
TGCAACAAGGAAGACATATGGCTGCACGTTGATGCAGCCTACGCAGGCAGTGCATTCATC
TGCCCTGAGTTCCGGCACCTTCTGAATGGAGTGGAGTTTGCAGATTCATTCAACTTTAAT
CCCCACAAATGGCTATTGGTGAATTTTGACTGTTCTGCCATGTGGGTGAAAAAGAGAACA
GACTTAACGGGAGCCTTTAGACTGGACCCCACTTACCTGAAGCACAGCCATCAGGATTCA
GGGCTTATCACTGACTACCGGCATTGGCAGATACCACTGGGCAGAAGATTTCGCTCTTTG
AAAATGTGGTTTGTATTTAGGATGTATGGAGTCAAAGGACTGCAGGCTTATATCCGCAAG
CATGTCCAGCTGTCCCATGAGTTTGAGTCACTGGTGCGCCAGGATCCCCGCTTTGAAATC
TGTGTGGAAGTCATTCTGGGGCTTGTCTGCTTTCGGCTAAAGGGTTCCAACAAAGTGAAT
GAAGCTCTTCTGCAAAGAATAAACAGTGCCAAAAAAATCCACTTGGTTCCATGTCACCTC
AGGGACAAGTTTGTCCTGCGCTTTGCCATCTGTTCTCGCACGGTGGAATCTGCCCATGTG
CAGCGGGCCTGGGAACACATCAAAGAGCTGGCGGCCGACGTGCTGCGAGCAGAGAGGGAG
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1518
Start on reference sequence 76
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DDC
Symbol Nomenclature : DDC
SYNONYM : AADC
Designation : aromatic-L-amino-acid decarboxylase
Full Nomenclature : dopa decarboxylase (aromatic L-amino acid decarboxylase)
GENEID : 1644
HGNC : 2719
MIM : 107930
Vega : OTTHUMG00000023353
Target GenBank: BC008366

 

Reference Sequence Alignment

  

HsCD00074654        ATGAACGCAAGTGAATTCCGAAGGAGAGGGAAGGAGATGGTGGATTACGTGGCCAACTAC
NM_001082971.1      ATGAACGCAAGTGAATTCCGAAGGAGAGGGAAGGAGATGGTGGATTACGTGGCCAACTAC
NM_000790.3         ATGAACGCAAGTGAATTCCGAAGGAGAGGGAAGGAGATGGTGGATTACGTGGCCAACTAC
NM_001242886.1      ATGAACGCAAGTGAATTCCGAAGGAGAGGGAAGGAGATGGTGGATTACGTGGCCAACTAC
                    ************************************************************

HsCD00074654        ATGGAAGGCATTGAGGGACGCCAGGTCTACCCTGACGTGGAGCCCGGGTACCTGCGGCCG
NM_001082971.1      ATGGAAGGCATTGAGGGACGCCAGGTCTACCCTGACGTGGAGCCCGGGTACCTGCGGCCG
NM_000790.3         ATGGAAGGCATTGAGGGACGCCAGGTCTACCCTGACGTGGAGCCCGGGTACCTGCGGCCG
NM_001242886.1      ATGGAAGGCATTGAGGGACGCCAGGTCTACCCTGACGTGGAGCCCGGGTACCTGCGGCCG
                    ************************************************************

HsCD00074654        CTGATCCCTGCCGCTGCCCCTCAGGAGCCAGACACGTTTGAGGACATCATCAACGACGTT
NM_001082971.1      CTGATCCCTGCCGCTGCCCCTCAGGAGCCAGACACGTTTGAGGACATCATCAACGACGTT
NM_000790.3         CTGATCCCTGCCGCTGCCCCTCAGGAGCCAGACACGTTTGAGGACATCATCAACGACGTT
NM_001242886.1      CTGATCCCTGCCGCTGCCCCTCAGGAGCCAGACACGTTTGAGGACATCATCAACGACGTT
                    ************************************************************

HsCD00074654        GAGAAGATAATCATGCCTGGGGTGACGCACTGGCACAGCCCCTACTTCTTCGCCTACTTC
NM_001082971.1      GAGAAGATAATCATGCCTGGGGTGACGCACTGGCACAGCCCCTACTTCTTCGCCTACTTC
NM_000790.3         GAGAAGATAATCATGCCTGGGGTGACGCACTGGCACAGCCCCTACTTCTTCGCCTACTTC
NM_001242886.1      GAGAAGATAATCATGCCTGGG---------------------------------------
                    *********************                                       

HsCD00074654        CCCACTGCCAGCTCGTACCCGGCCATGCTTGCGGACATGCTGTGCGGGGCCATTGGCTGC
NM_001082971.1      CCCACTGCCAGCTCGTACCCGGCCATGCTTGCGGACATGCTGTGCGGGGCCATTGGCTGC
NM_000790.3         CCCACTGCCAGCTCGTACCCGGCCATGCTTGCGGACATGCTGTGCGGGGCCATTGGCTGC
NM_001242886.1      ------------------------------------------------------------
                                                                                

HsCD00074654        ATCGGCTTCTCCTGGGCGGCAAGCCCAGCATGCACAGAGCTGGAGACTGTGATGATGGAC
NM_001082971.1      ATCGGCTTCTCCTGGGCGGCAAGCCCAGCATGCACAGAGCTGGAGACTGTGATGATGGAC
NM_000790.3         ATCGGCTTCTCCTGGGCGGCAAGCCCAGCATGCACAGAGCTGGAGACTGTGATGATGGAC
NM_001242886.1      ---------------GCGGCAAGCCCAGCATGCACAGAGCTGGAGACTGTGATGATGGAC
                                   *********************************************

HsCD00074654        TGGCTCGGGAAGATGCTGGAACTACCAAAGGCATTTTTGAATGAGAAAGCTGGAGAAGGG
NM_001082971.1      TGGCTCGGGAAGATGCTGGAACTACCAAAGGCATTTTTGAATGAGAAAGCTGGAGAAGGG
NM_000790.3         TGGCTCGGGAAGATGCTGGAACTACCAAAGGCATTTTTGAATGAGAAAGCTGGAGAAGGG
NM_001242886.1      TGGCTCGGGAAGATGCTGGAACTACCAAAGGCATTTTTGAATGAGAAAGCTGGAGAAGGG
                    ************************************************************

HsCD00074654        GGAGGAGTGATCCAGGGAAGTGCCAGTGAAGCCACCCTGGTGGCCCTGCTGGCCGCTCGG
NM_001082971.1      GGAGGAGTGATCCAGGGAAGTGCCAGTGAAGCCACCCTGGTGGCCCTGCTGGCCGCTCGG
NM_000790.3         GGAGGAGTGATCCAGGGAAGTGCCAGTGAAGCCACCCTGGTGGCCCTGCTGGCCGCTCGG
NM_001242886.1      GGAGGAGTGATCCAGGGAAGTGCCAGTGAAGCCACCCTGGTGGCCCTGCTGGCCGCTCGG
                    ************************************************************

HsCD00074654        ACCAAAGTGATCCATCGGCTGCAGGCAGCGTCCCCAGAGCTCACACAGGCCGCTATCATG
NM_001082971.1      ACCAAAGTGATCCATCGGCTGCAGGCAGCGTCCCCAGAGCTCACACAGGCCGCTATCATG
NM_000790.3         ACCAAAGTGATCCATCGGCTGCAGGCAGCGTCCCCAGAGCTCACACAGGCCGCTATCATG
NM_001242886.1      ACCAAAGTGATCCATCGGCTGCAGGCAGCGTCCCCAGAGCTCACACAGGCCGCTATCATG
                    ************************************************************

HsCD00074654        GAGAAGCTGGTGGCTTACTCATCCGATCAGGCACACTCCTCAGTGGAAAGAGCTGGGTTA
NM_001082971.1      GAGAAGCTGGTGGCTTACTCATCCGATCAGGCACACTCCTCAGTGGAAAGAGCTGGGTTA
NM_000790.3         GAGAAGCTGGTGGCTTACTCATCCGATCAGGCACACTCCTCAGTGGAAAGAGCTGGGTTA
NM_001242886.1      GAGAAGCTGGTGGCTTACTCATCCGATCAGGCACACTCCTCAGTGGAAAGAGCTGGGTTA
                    ************************************************************

HsCD00074654        ATTGGTGGAGTGAAATTAAAAGCCATCCCCTCAGATGGCAACTTCGCCATGCGTGCGTCT
NM_001082971.1      ATTGGTGGAGTGAAATTAAAAGCCATCCCCTCAGATGGCAACTTCGCCATGCGTGCGTCT
NM_000790.3         ATTGGTGGAGTGAAATTAAAAGCCATCCCCTCAGATGGCAACTTCGCCATGCGTGCGTCT
NM_001242886.1      ATTGGTGGAGTGAAATTAAAAGCCATCCCCTCAGATGGCAACTTCGCCATGCGTGCGTCT
                    ************************************************************

HsCD00074654        GCCCTGCAGGAAGCCCTGGAGAGAGACAAAGCGGCTGGCCTGATTCCTTTCTTTATGGTT
NM_001082971.1      GCCCTGCAGGAAGCCCTGGAGAGAGACAAAGCGGCTGGCCTGATTCCTTTCTTTATGGTT
NM_000790.3         GCCCTGCAGGAAGCCCTGGAGAGAGACAAAGCGGCTGGCCTGATTCCTTTCTTTATGGTT
NM_001242886.1      GCCCTGCAGGAAGCCCTGGAGAGAGACAAAGCGGCTGGCCTGATTCCTTTCTTTATGGTT
                    ************************************************************

HsCD00074654        GCCACCCTGGGGACCACAACATGCTGCTCCTTTGACAATCTCTTAGAAGTCGGTCCTATC
NM_001082971.1      GCCACCCTGGGGACCACAACATGCTGCTCCTTTGACAATCTCTTAGAAGTCGGTCCTATC
NM_000790.3         GCCACCCTGGGGACCACAACATGCTGCTCCTTTGACAATCTCTTAGAAGTCGGTCCTATC
NM_001242886.1      GCCACCCTGGGGACCACAACATGCTGCTCCTTTGACAATCTCTTAGAAGTCGGTCCTATC
                    ************************************************************

HsCD00074654        TGCAACAAGGAAGACATATGGCTGCACGTTGATGCAGCCTACGCAGGCAGTGCATTCATC
NM_001082971.1      TGCAACAAGGAAGACATATGGCTGCACGTTGATGCAGCCTACGCAGGCAGTGCATTCATC
NM_000790.3         TGCAACAAGGAAGACATATGGCTGCACGTTGATGCAGCCTACGCAGGCAGTGCATTCATC
NM_001242886.1      TGCAACAAGGAAGACATATGGCTGCACGTTGATGCAGCCTACGCAGGCAGTGCATTCATC
                    ************************************************************

HsCD00074654        TGCCCTGAGTTCCGGCACCTTCTGAATGGAGTGGAGTTTGCAGATTCATTCAACTTTAAT
NM_001082971.1      TGCCCTGAGTTCCGGCACCTTCTGAATGGAGTGGAGTTTGCAGATTCATTCAACTTTAAT
NM_000790.3         TGCCCTGAGTTCCGGCACCTTCTGAATGGAGTGGAGTTTGCAGATTCATTCAACTTTAAT
NM_001242886.1      TGCCCTGAGTTCCGGCACCTTCTGAATGGAGTGGAGTTTGCAGATTCATTCAACTTTAAT
                    ************************************************************

HsCD00074654        CCCCACAAATGGCTATTGGTGAATTTTGACTGTTCTGCCATGTGGGTGAAAAAGAGAACA
NM_001082971.1      CCCCACAAATGGCTATTGGTGAATTTTGACTGTTCTGCCATGTGGGTGAAAAAGAGAACA
NM_000790.3         CCCCACAAATGGCTATTGGTGAATTTTGACTGTTCTGCCATGTGGGTGAAAAAGAGAACA
NM_001242886.1      CCCCACAAATGGCTATTGGTGAATTTTGACTGTTCTGCCATGTGGGTGAAAAAGAGAACA
                    ************************************************************

HsCD00074654        GACTTAACGGGAGCCTTTAGACTGGACCCCACTTACCTGAAGCACAGCCATCAGGATTCA
NM_001082971.1      GACTTAACGGGAGCCTTTAGACTGGACCCCACTTACCTGAAGCACAGCCATCAGGATTCA
NM_000790.3         GACTTAACGGGAGCCTTTAGACTGGACCCCACTTACCTGAAGCACAGCCATCAGGATTCA
NM_001242886.1      GACTTAACGGGAGCCTTTAGACTGGACCCCACTTACCTGAAGCACAGCCATCAGGATTCA
                    ************************************************************

HsCD00074654        GGGCTTATCACTGACTACCGGCATTGGCAGATACCACTGGGCAGAAGATTTCGCTCTTTG
NM_001082971.1      GGGCTTATCACTGACTACCGGCATTGGCAGATACCACTGGGCAGAAGATTTCGCTCTTTG
NM_000790.3         GGGCTTATCACTGACTACCGGCATTGGCAGATACCACTGGGCAGAAGATTTCGCTCTTTG
NM_001242886.1      GGGCTTATCACTGACTACCGGCATTGGCAGATACCACTGGGCAGAAGATTTCGCTCTTTG
                    ************************************************************

HsCD00074654        AAAATGTGGTTTGTATTTAGGATGTATGGAGTCAAAGGACTGCAGGCTTATATCCGCAAG
NM_001082971.1      AAAATGTGGTTTGTATTTAGGATGTATGGAGTCAAAGGACTGCAGGCTTATATCCGCAAG
NM_000790.3         AAAATGTGGTTTGTATTTAGGATGTATGGAGTCAAAGGACTGCAGGCTTATATCCGCAAG
NM_001242886.1      AAAATGTGGTTTGTATTTAGGATGTATGGAGTCAAAGGACTGCAGGCTTATATCCGCAAG
                    ************************************************************

HsCD00074654        CATGTCCAGCTGTCCCATGAGTTTGAGTCACTGGTGCGCCAGGATCCCCGCTTTGAAATC
NM_001082971.1      CATGTCCAGCTGTCCCATGAGTTTGAGTCACTGGTGCGCCAGGATCCCCGCTTTGAAATC
NM_000790.3         CATGTCCAGCTGTCCCATGAGTTTGAGTCACTGGTGCGCCAGGATCCCCGCTTTGAAATC
NM_001242886.1      CATGTCCAGCTGTCCCATGAGTTTGAGTCACTGGTGCGCCAGGATCCCCGCTTTGAAATC
                    ************************************************************

HsCD00074654        TGTGTGGAAGTCATTCTGGGGCTTGTCTGCTTTCGGCTAAAGGGTTCCAACAAAGTGAAT
NM_001082971.1      TGTGTGGAAGTCATTCTGGGGCTTGTCTGCTTTCGGCTAAAGGGTTCCAACAAAGTGAAT
NM_000790.3         TGTGTGGAAGTCATTCTGGGGCTTGTCTGCTTTCGGCTAAAGGGTTCCAACAAAGTGAAT
NM_001242886.1      TGTGTGGAAGTCATTCTGGGGCTTGTCTGCTTTCGGCTAAAGGGTTCCAACAAAGTGAAT
                    ************************************************************

HsCD00074654        GAAGCTCTTCTGCAAAGAATAAACAGTGCCAAAAAAATCCACTTGGTTCCATGTCACCTC
NM_001082971.1      GAAGCTCTTCTGCAAAGAATAAACAGTGCCAAAAAAATCCACTTGGTTCCATGTCACCTC
NM_000790.3         GAAGCTCTTCTGCAAAGAATAAACAGTGCCAAAAAAATCCACTTGGTTCCATGTCACCTC
NM_001242886.1      GAAGCTCTTCTGCAAAGAATAAACAGTGCCAAAAAAATCCACTTGGTTCCATGTCACCTC
                    ************************************************************

HsCD00074654        AGGGACAAGTTTGTCCTGCGCTTTGCCATCTGTTCTCGCACGGTGGAATCTGCCCATGTG
NM_001082971.1      AGGGACAAGTTTGTCCTGCGCTTTGCCATCTGTTCTCGCACGGTGGAATCTGCCCATGTG
NM_000790.3         AGGGACAAGTTTGTCCTGCGCTTTGCCATCTGTTCTCGCACGGTGGAATCTGCCCATGTG
NM_001242886.1      AGGGACAAGTTTGTCCTGCGCTTTGCCATCTGTTCTCGCACGGTGGAATCTGCCCATGTG
                    ************************************************************

HsCD00074654        CAGCGGGCCTGGGAACACATCAAAGAGCTGGCGGCCGACGTGCTGCGAGCAGAGAGGGAG
NM_001082971.1      CAGCGGGCCTGGGAACACATCAAAGAGCTGGCGGCCGACGTGCTGCGAGCAGAGAGGGAG
NM_000790.3         CAGCGGGCCTGGGAACACATCAAAGAGCTGGCGGCCGACGTGCTGCGAGCAGAGAGGGAG
NM_001242886.1      CAGCGGGCCTGGGAACACATCAAAGAGCTGGCGGCCGACGTGCTGCGAGCAGAGAGGGAG
                    ************************************************************

HsCD00074654        TAG
NM_001082971.1      TAG
NM_000790.3         TAG
NM_001242886.1      TAG
                    ***

Pathways

Panther : 5-Hydroxytryptamine biosynthesis
Panther : Adrenaline and noradrenaline biosynthesis
Panther : Dopamine receptor mediated signaling pathway
Panther : Nicotine pharmacodynamics pathway
Reactome : Amine-derived hormones
Reactome : Catecholamine biosynthesis
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Serotonin and melatonin biosynthesis
WikiPathway : Biogenic Amine Synthesis
WikiPathway : Nicotine Activity on Dopaminergic Neurons
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Tryptophan metabolism

Protein

UniProt : P20711
UniProt : Q53Y41
HPRD : 00145

Clone

Cloning Information : 213299
HIP Master Clone ID : 28903
Original Clone ID : FLH213299.01X

Organism


TAX_ID : 9606
Species Specific ID: 1644

Genome

Chromosome : 7
Map Location : 7p12.2
Ensembl : ENSG00000132437

Reagents

Labome : DDC-antibody