DNASU Plasmid Repository • 480.965.5697 | Email

HIF1A (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  HIF1A
Gene Name:  hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Original Clone ID: FLH213354.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: PMID: 23303788
Title: Oxygen-dependent expression of cytochrome c oxidase subunit 4-2 gene expression is mediated by transcription factors RBPJ, CXXC5 and CHCHD2

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 2481nts         Open reading frame : 1 to 2481
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2744
Start on reference sequence 264
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : HIF1A
Symbol Nomenclature : HIF1A
Designation : ARNT interacting protein|ARNT-interacting protein|HIF-1-alpha|PAS domain-containing protein 8|basic-helix-loop-helix-PAS protein MOP1|class E basic helix-loop-helix protein 78|hypoxia-inducible factor 1 alpha isoform I.3|hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)|hypoxia-inducible factor 1-alpha|hypoxia-inducible factor1alpha|member of PAS protein 1|member of PAS superfamily 1
Full Nomenclature : hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
GENEID : 3091
HGNC : 4910
MIM : 603348
Vega : OTTHUMG00000140344
Target GenBank: BC012527


Reference Sequence Alignment


HsCD00074691        ------------------------------------------------------------
NM_001530.3         ------------------------------------------------------------

                                .:.**.   *..*... *. .*:.**.** ..:*.*************











































NCI : AP-1 transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
NCI : Notch-mediated HES/HEY network
NCI : VEGFR1 specific signals
Panther : Angiogenesis
Panther : Hypoxia response via HIF activation
Panther : VEGF signaling pathway
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Oxygen-dependent asparagine hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of gene expression by Hypoxia-inducible Factor
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
WikiPathway : Adipogenesis
WikiPathway : Angiogenesis
WikiPathway : Notch Signaling Pathway


Cloning Information : 213354
HIP Master Clone ID : 55259
Original Clone ID : FLH213354.01X


TAX_ID : 9606
Species Specific ID: 3091


Chromosome : 14
Map Location : 14q23.2
Ensembl : ENSG00000100644


Labome : HIF-1-alpha-antibody