DNASU Plasmid Repository • 480.965.5697 | Email

CIRBP (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CIRBP
Gene Name:  cold inducible RNA binding protein
Sequence             
Original Clone ID: FLH217528.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00075022

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 519nts         Open reading frame : 1 to 519

ATGGCATCAGATGAAGGCAAACTTTTTGTTGGAGGGCTGAGTTTTGACACCAATGAGCAG
TCGCTGGAGCAGGTCTTCTCAAAGTACGGACAGATCTCTGAAGTGGTGGTTGTGAAAGAC
AGGGAGACCCAGAGATCTCGGGGATTTGGGTTTGTCACCTTTGAGAACATTGACGACGCT
AAGGATGCCATGATGGCCATGAATGGGAAGTCTGTAGATGGACGGCAGATCCGAGTAGAC
CAGGCAGGCAAGTCGTCAGACAACCGATCCCGTGGGTACCGTGGTGGCTCTGCCGGGGGC
CGGGGCTTCTTCCGTGGGGGCCGAGGACGGGGCCGTGGGTTCTCTAGAGGAGGAGGGGAC
CGAGGCTATGGGGGGAACCGGTTCGAGTCCAGGAGTGGGGGCTACGGAGGCTCCAGAGAC
TACTATAGCAGCCGGAGTCAGAGTGGTGGCTACAGTGACCGGAGCTCGGGCGGGTCCTAC
AGAGACAGTTACGACAGTTACGCTACACACAACGAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 585
Start on reference sequence 67
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CIRBP
Symbol Nomenclature : CIRBP
SYNONYM : CIRP
Designation : A18 hnRNP|cold inducible RNA-binding protein|cold-inducible RNA-binding protein|glycine-rich RNA binding protein|glycine-rich RNA-binding protein CIRP
Full Nomenclature : cold inducible RNA binding protein
GENEID : 1153
HGNC : 1982
MIM : 602649
Vega : OTTHUMG00000180145
Target GenBank: BC000901

 

Protein

SMART domain : RRM_1 : RNA recognition motif
SMART domain : RRM : RNA recognition motif
UniProt : Q53XX5
UniProt : Q14011
HPRD : 08375

Clone

Cloning Information : 217528
HIP Master Clone ID : 28870
Original Clone ID : FLH217528.01X

Organism


TAX_ID : 9606
Species Specific ID: 1153

Genome

Chromosome : 19
Map Location : 19p13.3
Ensembl : ENSG00000099622