DNASU Plasmid Repository • 480.965.5697 | Email

PPIL2 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPIL2
Gene Name:  peptidylprolyl isomerase (cyclophilin)-like 2
Sequence             
Original Clone ID: FLH252583.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00075799

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1584nts         Open reading frame : 1 to 1584
Reference Sequence Alignment

ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAATGCTGCCCAC
TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
GGCAAGTACATCAACCCAGCAGCCACCGAGCAGCAGAGGAAGAGCCCTCAACCAGTGCCA
CTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGGTAGC
AGCAGGCTGCCTGATGACCACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1671
Start on reference sequence 88
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPIL2
Symbol Nomenclature : PPIL2
SYNONYM : CYC4; CYP60; Cyp-60; UBOX7; hCyP-60
Designation : PPIase|U-box domain containing 7|cyclophilin, 60kDa|cyclophilin-60|cyclophilin-like protein CyP-60|peptidyl-prolyl cis-trans isomerase-like 2|peptidylprolyl cis-trans isomerase|rotamase PPIL2
Full Nomenclature : peptidylprolyl isomerase (cyclophilin)-like 2
GENEID : 23759
HGNC : 9261
MIM : 607588
Vega : OTTHUMG00000030174
Target GenBank: BC000022

 

Reference Sequence Alignment

  

HsCD00075799      ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
NM_148175.2       ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
NM_148176.2       ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
NM_014337.3       ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
                  ************************************************************

HsCD00075799      TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
NM_148175.2       TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
NM_148176.2       TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
NM_014337.3       TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
                  ************************************************************

HsCD00075799      CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
NM_148175.2       CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
NM_148176.2       CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
NM_014337.3       CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
                  ************************************************************

HsCD00075799      TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
NM_148175.2       TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
NM_148176.2       TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
NM_014337.3       TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
                  ************************************************************

HsCD00075799      GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
NM_148175.2       GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
NM_148176.2       GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
NM_014337.3       GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
                  ************************************************************

HsCD00075799      TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
NM_148175.2       TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
NM_148176.2       TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
NM_014337.3       TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
                  ************************************************************

HsCD00075799      ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
NM_148175.2       ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
NM_148176.2       ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
NM_014337.3       ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
                  ************************************************************

HsCD00075799      TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
NM_148175.2       TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
NM_148176.2       TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
NM_014337.3       TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
                  ************************************************************

HsCD00075799      CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
NM_148175.2       CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
NM_148176.2       CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
NM_014337.3       CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
                  ************************************************************

HsCD00075799      ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
NM_148175.2       ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
NM_148176.2       ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
NM_014337.3       ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
                  ************************************************************

HsCD00075799      AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
NM_148175.2       AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
NM_148176.2       AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
NM_014337.3       AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
                  ************************************************************

HsCD00075799      CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAATGCTGCCCAC
NM_148175.2       CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
NM_148176.2       CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
NM_014337.3       CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
                  ************************************************** *********

HsCD00075799      TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
NM_148175.2       TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
NM_148176.2       TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
NM_014337.3       TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
                  ************************************************************

HsCD00075799      CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
NM_148175.2       CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
NM_148176.2       CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
NM_014337.3       CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
                  ************************************************************

HsCD00075799      TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
NM_148175.2       TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
NM_148176.2       TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
NM_014337.3       TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
                  ************************************************************

HsCD00075799      CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
NM_148175.2       CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
NM_148176.2       CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
NM_014337.3       CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
                  ************************************************************

HsCD00075799      TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
NM_148175.2       TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
NM_148176.2       TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
NM_014337.3       TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
                  ************************************************************

HsCD00075799      GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
NM_148175.2       GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
NM_148176.2       GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
NM_014337.3       GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
                  ************************************************************

HsCD00075799      ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
NM_148175.2       ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
NM_148176.2       ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
NM_014337.3       ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
                  ************************************************************

HsCD00075799      TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
NM_148175.2       TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
NM_148176.2       TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
NM_014337.3       TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
                  ************************************************************

HsCD00075799      GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
NM_148175.2       GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
NM_148176.2       GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
NM_014337.3       GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
                  ************************************************************

HsCD00075799      CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
NM_148175.2       CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
NM_148176.2       CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
NM_014337.3       CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
                  ************************************************************

HsCD00075799      GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
NM_148175.2       GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
NM_148176.2       GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
NM_014337.3       GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
                  ************************************************************

HsCD00075799      GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
NM_148175.2       GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
NM_148176.2       GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
NM_014337.3       GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
                  ************************************************************

HsCD00075799      GGCAAGTACATCAACCCAGCAGCCACCGAGCAG----CAGAGGAAGAGCCCTCAACCAGT
NM_148175.2       GGCAAGTACATCAACCCAGCAGCCACGAAGCGAGCAGCAGAGGAAGAGCCCTCAACCAGT
NM_148176.2       GGCAAGTACATCAACCCAGCAGCCACCGAGCAG----CAGAGGAAGAGCCCTCAACCAGT
NM_014337.3       GGCAAGTACATCAACCCAGCAGCCACGAAGCGAGCAGCAGAGGAAGAGCCCTCAACCAGT
                  ************************** .***..    ***********************

HsCD00075799      GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
NM_148175.2       GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
NM_148176.2       GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
NM_014337.3       GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
                  ************************************************************

HsCD00075799      TAGCAGCAGGCTGCCTGATGACCACTAG
NM_148175.2       TAG-------------------------
NM_148176.2       TAGCAGCAGGCTGCCTGATGACCACTAG
NM_014337.3       TAG-------------------------
                  ***                         

Pathways

Reactome : Basigin interactions
Reactome : Cell surface interactions at the vascular wall
Reactome : Hemostasis

Protein

SMART domain : Ubox : Modified RING finger domain
UniProt : Q13356
HPRD : 08472

Clone

Cloning Information : 252583
HIP Master Clone ID : 32520
Original Clone ID : FLH252583.01X

Organism


TAX_ID : 9606
Species Specific ID: 23759

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000100023

Reagents

Labome : PPIL2-antibody