DNASU Plasmid Repository • 480.965.5697 | Email

ADFP (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)


Explanation of Terms

Gene: Gene Symbol:  PLIN2
Gene Name:  perilipin 2
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH225954.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: PMID: 23762027
Title: Increased Long Chain acyl-Coa Synthetase Activity and Fatty Acid Import Is Linked to Membrane Synthesis for Development of Picornavirus Replication Organelles
PMID: 23762027
Title: Increased Long Chain acyl-Coa Synthetase Activity and Fatty Acid Import Is Linked to Membrane Synthesis for Development of Picornavirus Replication Organelles

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1314nts         Open reading frame : 1 to 1314
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1399
Start on reference sequence 86
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway&reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and NAP138 and ccdB and ColE and AmpR and T7 and attR2 and GST and CmR; ampicillin resistance in bacterial;
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3249 3931
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2384 2405
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4029 4688
tag GST Glutathione transferase (GST) tag 2282 2950


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PLIN2
Symbol Nomenclature : PLIN2
Designation : adipophilin|adipose differentiation-related protein|perilipin-2
Full Nomenclature : perilipin 2
GENEID : 123
Locus Tag : RP11-151J10.1
HGNC : 248
MIM : 103195
Vega : OTTHUMG00000019624
Target GenBank: BC005127


Reference Sequence Alignment

























NCI : HIF-1-alpha transcription factor network
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PPARA activates gene expression
Reactome : Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha)
WikiPathway : Adipogenesis


UniProt : Q99541
UniProt : Q6FHZ7
HPRD : 00057


Cloning Information : 225954
HIP Master Clone ID : 166285
Original Clone ID : FLH225954.01L


TAX_ID : 9606
Species Specific ID: 123


Chromosome : 9
Map Location : 9p22.1
Ensembl : ENSG00000147872


Labome : PLIN2-antibody