DNASU Plasmid Repository • 480.965.5697 | Email

POLR3G (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR3G
Gene Name:  polymerase (RNA) III (DNA directed) polypeptide G (32kD)
Sequence             
Original Clone ID: FLH264727.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00080109

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 672nts         Open reading frame : 1 to 672

ATGGCTGGGAATAAAGGAAGAGGACGTGCTGCTTATACCTTTAATATTGAGGCTGTTGGA
TTTAGCAAAGGTGAAAAGTTACCTGATGTAGTGTTGAAACCACCCCCACTATTTCCTGAT
ACAGATTATAAACCAGTGCCACTGAAAACAGGAGAAGGTGAAGAATATATGCTGGCTTTG
AAACAGGAGTTGAGAGAAACAATGAAAAGAATGCCTTATTTTATTGAAACACCTGAAGAA
AGACAAGATATTGAAAGGTATAGTAAAAGATACATGAAGGTATACAAGGAAGAATGGATA
CCAGATTGGAGAAGACTTCCAAGAGAGATGATGCCAAGAAATAAATGTAAAAAAGCAGGC
CCAAAACCCAAAAAGGCAAAAGACGCAGGCAAAGGCACACCACTCACTAATACTGAAGAT
GTGTTGAAAAAAATGGAGGAATTGGAAAAAAGAGGTGATGGTGAAAAATCAGATGAGGAA
AATGAAGAGAAAGAAGGAAGCAAAGAGAAAAGTAAAGAAGGTGATGATGACGATGACGAT
GATGCCGCAGAACAGGAGGAATATGATGAAGAAGAGCAAGAAGAGGAAAATGACTACATT
AATTCATACTTTGAAGATGGAGATGATTTTGGCGCAGACAGTGATGACAACATGGATGAG
GCAACCTATTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 872
Start on reference sequence 201
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR3G
Symbol Nomenclature : POLR3G
SYNONYM : RPC32; RPC7
Designation : DNA-directed RNA polymerase III 32 kDa polypeptide|DNA-directed RNA polymerase III subunit G|DNA-directed RNA polymerase III subunit RPC7|RNA polymerase III 32 kDa subunit|RNA polymerase III subunit C7
Full Nomenclature : polymerase (RNA) III (DNA directed) polypeptide G (32kD)
GENEID : 10622
GI : 146327608
GenBank Accession : BC141649
HGNC : 30075
Vega : OTTHUMG00000162809
Target GenBank: NM_006467

 

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Gene Expression
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Transcription

Protein

UniProt : O15318
HPRD : 17881

Clone

Cloning Information : 264727
HIP Master Clone ID : 196825
IMAGE ID : 100014639
Original Clone ID : FLH264727.01X

Organism


TAX_ID : 9606
Species Specific ID: 10622

Genome

Chromosome : 5
Map Location : 5q14.3
Ensembl : ENSG00000113356

Reagents

Labome : POLR3G-antibody