DNASU Plasmid Repository • 480.965.5697 | Email

SLC27A5 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLC27A5
Gene Name:  solute carrier family 27 (fatty acid transporter), member 5
Sequence             
Original Clone ID: FLH264925.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00080305

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2070nts         Open reading frame : 1 to 2070
Reference Sequence Alignment

ATGGGTGTCAGGCAACAGTTGGCCTTGCTGCTGCTGCTGCTGCTCCTGCTCTGGGGCCTG
GGGCAGCCAGTGTGGCCAGTCGCTGTGGCCTTGACCCTGCGCTGGCTCCTGGGGGATCCC
ACATGTTGCGTGCTACTTGGGCTGGCCATGTTAGCACGGCCCTGGCTCGGCCCCTGGGTG
CCCCATGGGCTGAGCCTGGCAGCTGCGGCCCTGGCACTAACCCTCCTGCCAGCACGGCTG
CCCCCAGGACTACGCTGGCTGCCGGCTGATGTGATCTTCTTGGCCAAGATCCTCCACCTG
GGCCTGAAGATCAGGGGATGCTTGAGCCGGCAGCCGCCTGACACCTTTGTAGATGCCTTC
GAGCGGCGAGCACGAGCGCAGCCTGGCAGGGCACTCTTGGTGTGGACGGGGCCTGGGGCC
GGCTCAGTCACCTTTGGTGAGCTGGATGCCCGGGCCTGCCAGGCGGCATGGGCCCTGAAG
GCTGAGCTGGGTGACCCTGCGAGCCTGTGTGCCGGGGAGCCTACTGCCCTCCTTGTGCTG
GCTTCCCAGGCCGTTCCAGCCCTGTGTATGTGGCTGGGGCTGGCCAAGCTGGGCTGCCCA
ACAGCCTGGATCAACCCGCATGGCCGGGGGATGCCCCTGGCGCACTCTGTGCTGAGCTCT
GGGGCCCGGGTGCTGGTGGTGGACCCAGACCTCCGGGAGAGCCTGGAGGAGATCCTTCCC
AAGCTGCAGGCTGAGAACATCCGCTGCTTCTACCTCAGCCATACCTCCCCTACACCAGGG
GTGGGGGCTCTGGGGGCTGCCCTGGATGCAGCGCCCTCCCACCCAGTGCCTGCTGACCTG
CGTGCTGGGATCACATGGAGAAGCCCTGCCCTCTTCATCTATACCTCGGGGACCACTGGC
CTCCCGAAGCCAGCCATCCTCACGCATGAGCGGGTACTGCAGATGAGCAAGATGCTGTCC
TTATCTGGGGCCACAGCTGATGATGTGGTTTACACGGTCCTGCCTCTGTACCACGTGATG
GGACTTGTCGTTGGGATCCTCGGCTGCTTAGATCTCGGAGCCACCTGTGTTCTGGCCCCC
AAGTTCTCTACTTCCTGCTTCTGGGATGACTGTCGGCAGCATGGCGTGACAGTGATCCTG
TATGTGGGCGAGCTCCTGCGGTACTTGTGTAACATTCCCCAGCAACCAGAGGACCGGACA
CATACAGTCCGCCTGGCAATGGGCAATGGACTACGGGCTGATGTGTGGGAGACCTTCCAG
CAGCGCTTCGGTCCTATTCGGATCTGGGAAGTCTACGGCTCCACAGAAGGCAACATGGGC
TTAGTCAACTATGTGGGGCGCTGCGGGGCCCTGGGCAAGATGAGCTGCCTCCTCCGAATG
CTGTCCCCCTTTGAGCTGGTGCAGTTCGACATGGAGGCGGCGGAGCCTGTGAGGGACAAT
CAGGGCTTCTGCATCCCTGTAGGGCTAGGGGAGCCGGGGCTGCTGCTGACCAAGGTGGTA
AGCCAGCAACCCTTCGTGGGCTACCGCGGCCCCCGAGAGCTGTCGGAACGGAAGCTGGTG
CGCAACGTGCGGCAATCGGGCGACGTTTACTACAACACCGGGGACGTACTGGCCATGGAC
CGCGAAGGCTTCCTCTACTTCCGCGACCGCCTCGGGGACACCTTCCGATGGAAGGGCGAG
AACGTGTCCACGCACGAGGTGGAGGGCGTGTTGTCGCAGGTGGACTTCTTGCAACAGGTT
AACGTGTATGGCGTGTGCGTGCCAGGTTGTGAGGGTAAGGTGGGCATGGCTGCTGTGCAG
CTAGCCCCCGGCCAGACTTTCGACGGGGAGAAGTTGTACCAGCACGTTCGCGCTTGGCTC
CCTGCCTACGCTACCCCCCATTTCATCCGCATCCAGGACGCCATGGAGGTCACCAGCACG
TTCAAACTGATGAAGACCCGGTTGGTGCGTGAGGGCTTCAATGTGGGGATCGTGGTTGAC
CCTCTGTTTGTACTGGACAACCGGGCCCAGTCCTTCCGGCCCCTGACGGCAGAAATGTAC
CAGGCTGTGTGTGAGGGAACCTGGAGGCTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2143
Start on reference sequence 71
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLC27A5
Symbol Nomenclature : SLC27A5
SYNONYM : ACSB; ACSVL6; BACS; BAL; FACVL3; FATP-5; FATP5; VLACSR; VLCS-H2; VLCSH2
Designation : BA-CoA ligase|VLACS-related|bile acid-CoA ligase|bile acyl-CoA synthetase|cholate--CoA ligase|fatty acid transport protein 5|fatty-acid-Coenzyme A ligase, very long-chain 3|solute carrier family 27 member 5|very long-chain acyl-CoA synthetase homolog 2|very long-chain acyl-CoA synthetase-related protein
Full Nomenclature : solute carrier family 27 (fatty acid transporter), member 5
GENEID : 10998
GI : 148921777
GenBank Accession : BC146387
HGNC : 10999
MIM : 603314
Vega : OTTHUMG00000183543
Target GenBank: NM_012254

 

Reference Sequence Alignment

  

HsCD00080305      ATGGGTGTCAGGCAACAGTTGGCCTTGCTGCTGCTGCTGCTGCTCCTGCTCTGGGGCCTG
NM_012254.2       ATGGGTGTCAGGCAACAGTTGGCCTTGCTGCTGCTGCTGCTGCTCCTGCTCTGGGGCCTG
                  ************************************************************

HsCD00080305      GGGCAGCCAGTGTGGCCAGTCGCTGTGGCCTTGACCCTGCGCTGGCTCCTGGGGGATCCC
NM_012254.2       GGGCAGCCAGTGTGGCCAGTCGCTGTGGCCTTGACCCTGCGCTGGCTCCTGGGGGATCCC
                  ************************************************************

HsCD00080305      ACATGTTGCGTGCTACTTGGGCTGGCCATGTTAGCACGGCCCTGGCTCGGCCCCTGGGTG
NM_012254.2       ACATGTTGCGTGCTACTTGGGCTGGCCATGTTAGCACGGCCCTGGCTCGGCCCCTGGGTG
                  ************************************************************

HsCD00080305      CCCCATGGGCTGAGCCTGGCAGCTGCGGCCCTGGCACTAACCCTCCTGCCAGCACGGCTG
NM_012254.2       CCCCATGGGCTGAGCCTGGCAGCTGCGGCCCTGGCACTAACCCTCCTGCCAGCACGGCTG
                  ************************************************************

HsCD00080305      CCCCCAGGACTACGCTGGCTGCCGGCTGATGTGATCTTCTTGGCCAAGATCCTCCACCTG
NM_012254.2       CCCCCAGGACTACGCTGGCTGCCGGCTGATGTGATCTTCTTGGCCAAGATCCTCCACCTG
                  ************************************************************

HsCD00080305      GGCCTGAAGATCAGGGGATGCTTGAGCCGGCAGCCGCCTGACACCTTTGTAGATGCCTTC
NM_012254.2       GGCCTGAAGATCAGGGGATGCTTGAGCCGGCAGCCGCCTGACACCTTTGTAGATGCCTTC
                  ************************************************************

HsCD00080305      GAGCGGCGAGCACGAGCGCAGCCTGGCAGGGCACTCTTGGTGTGGACGGGGCCTGGGGCC
NM_012254.2       GAGCGGCGAGCACGAGCGCAGCCTGGCAGGGCACTCTTGGTGTGGACGGGGCCTGGGGCC
                  ************************************************************

HsCD00080305      GGCTCAGTCACCTTTGGTGAGCTGGATGCCCGGGCCTGCCAGGCGGCATGGGCCCTGAAG
NM_012254.2       GGCTCAGTCACCTTTGGTGAGCTGGATGCCCGGGCCTGCCAGGCGGCATGGGCCCTGAAG
                  ************************************************************

HsCD00080305      GCTGAGCTGGGTGACCCTGCGAGCCTGTGTGCCGGGGAGCCTACTGCCCTCCTTGTGCTG
NM_012254.2       GCTGAGCTGGGTGACCCTGCGAGCCTGTGTGCCGGGGAGCCTACTGCCCTCCTTGTGCTG
                  ************************************************************

HsCD00080305      GCTTCCCAGGCCGTTCCAGCCCTGTGTATGTGGCTGGGGCTGGCCAAGCTGGGCTGCCCA
NM_012254.2       GCTTCCCAGGCCGTTCCAGCCCTGTGTATGTGGCTGGGGCTGGCCAAGCTGGGCTGCCCA
                  ************************************************************

HsCD00080305      ACAGCCTGGATCAACCCGCATGGCCGGGGGATGCCCCTGGCGCACTCTGTGCTGAGCTCT
NM_012254.2       ACAGCCTGGATCAACCCGCATGGCCGGGGGATGCCCCTGGCGCACTCTGTGCTGAGCTCT
                  ************************************************************

HsCD00080305      GGGGCCCGGGTGCTGGTGGTGGACCCAGACCTCCGGGAGAGCCTGGAGGAGATCCTTCCC
NM_012254.2       GGGGCCCGGGTGCTGGTGGTGGACCCAGACCTCCGGGAGAGCCTGGAGGAGATCCTTCCC
                  ************************************************************

HsCD00080305      AAGCTGCAGGCTGAGAACATCCGCTGCTTCTACCTCAGCCATACCTCCCCTACACCAGGG
NM_012254.2       AAGCTGCAGGCTGAGAACATCCGCTGCTTCTACCTCAGCCATACCTCCCCTACACCAGGG
                  ************************************************************

HsCD00080305      GTGGGGGCTCTGGGGGCTGCCCTGGATGCAGCGCCCTCCCACCCAGTGCCTGCTGACCTG
NM_012254.2       GTGGGGGCTCTGGGGGCTGCCCTGGATGCAGCGCCCTCCCACCCAGTGCCTGCTGACCTG
                  ************************************************************

HsCD00080305      CGTGCTGGGATCACATGGAGAAGCCCTGCCCTCTTCATCTATACCTCGGGGACCACTGGC
NM_012254.2       CGTGCTGGGATCACATGGAGAAGCCCTGCCCTCTTCATCTATACCTCGGGGACCACTGGC
                  ************************************************************

HsCD00080305      CTCCCGAAGCCAGCCATCCTCACGCATGAGCGGGTACTGCAGATGAGCAAGATGCTGTCC
NM_012254.2       CTCCCGAAGCCAGCCATCCTCACGCATGAGCGGGTACTGCAGATGAGCAAGATGCTGTCC
                  ************************************************************

HsCD00080305      TTATCTGGGGCCACAGCTGATGATGTGGTTTACACGGTCCTGCCTCTGTACCACGTGATG
NM_012254.2       TTATCTGGGGCCACAGCTGATGATGTGGTTTACACGGTCCTGCCTCTGTACCACGTGATG
                  ************************************************************

HsCD00080305      GGACTTGTCGTTGGGATCCTCGGCTGCTTAGATCTCGGAGCCACCTGTGTTCTGGCCCCC
NM_012254.2       GGACTTGTCGTTGGGATCCTCGGCTGCTTAGATCTCGGAGCCACCTGTGTTCTGGCCCCC
                  ************************************************************

HsCD00080305      AAGTTCTCTACTTCCTGCTTCTGGGATGACTGTCGGCAGCATGGCGTGACAGTGATCCTG
NM_012254.2       AAGTTCTCTACTTCCTGCTTCTGGGATGACTGTCGGCAGCATGGCGTGACAGTGATCCTG
                  ************************************************************

HsCD00080305      TATGTGGGCGAGCTCCTGCGGTACTTGTGTAACATTCCCCAGCAACCAGAGGACCGGACA
NM_012254.2       TATGTGGGCGAGCTCCTGCGGTACTTGTGTAACATTCCCCAGCAACCAGAGGACCGGACA
                  ************************************************************

HsCD00080305      CATACAGTCCGCCTGGCAATGGGCAATGGACTACGGGCTGATGTGTGGGAGACCTTCCAG
NM_012254.2       CATACAGTCCGCCTGGCAATGGGCAATGGACTACGGGCTGATGTGTGGGAGACCTTCCAG
                  ************************************************************

HsCD00080305      CAGCGCTTCGGTCCTATTCGGATCTGGGAAGTCTACGGCTCCACAGAAGGCAACATGGGC
NM_012254.2       CAGCGCTTCGGTCCTATTCGGATCTGGGAAGTCTACGGCTCCACAGAAGGCAACATGGGC
                  ************************************************************

HsCD00080305      TTAGTCAACTATGTGGGGCGCTGCGGGGCCCTGGGCAAGATGAGCTGCCTCCTCCGAATG
NM_012254.2       TTAGTCAACTATGTGGGGCGCTGCGGGGCCCTGGGCAAGATGAGCTGCCTCCTCCGAATG
                  ************************************************************

HsCD00080305      CTGTCCCCCTTTGAGCTGGTGCAGTTCGACATGGAGGCGGCGGAGCCTGTGAGGGACAAT
NM_012254.2       CTGTCCCCCTTTGAGCTGGTGCAGTTCGACATGGAGGCGGCGGAGCCTGTGAGGGACAAT
                  ************************************************************

HsCD00080305      CAGGGCTTCTGCATCCCTGTAGGGCTAGGGGAGCCGGGGCTGCTGCTGACCAAGGTGGTA
NM_012254.2       CAGGGCTTCTGCATCCCTGTAGGGCTAGGGGAGCCGGGGCTGCTGCTGACCAAGGTGGTA
                  ************************************************************

HsCD00080305      AGCCAGCAACCCTTCGTGGGCTACCGCGGCCCCCGAGAGCTGTCGGAACGGAAGCTGGTG
NM_012254.2       AGCCAGCAACCCTTCGTGGGCTACCGCGGCCCCCGAGAGCTGTCGGAACGGAAGCTGGTG
                  ************************************************************

HsCD00080305      CGCAACGTGCGGCAATCGGGCGACGTTTACTACAACACCGGGGACGTACTGGCCATGGAC
NM_012254.2       CGCAACGTGCGGCAATCGGGCGACGTTTACTACAACACCGGGGACGTACTGGCCATGGAC
                  ************************************************************

HsCD00080305      CGCGAAGGCTTCCTCTACTTCCGCGACCGCCTCGGGGACACCTTCCGATGGAAGGGCGAG
NM_012254.2       CGCGAAGGCTTCCTCTACTTCCGCGACCGCCTCGGGGACACCTTCCGATGGAAGGGCGAG
                  ************************************************************

HsCD00080305      AACGTGTCCACGCACGAGGTGGAGGGCGTGTTGTCGCAGGTGGACTTCTTGCAACAGGTT
NM_012254.2       AACGTGTCCACGCACGAGGTGGAGGGCGTGTTGTCGCAGGTGGACTTCTTGCAACAGGTT
                  ************************************************************

HsCD00080305      AACGTGTATGGCGTGTGCGTGCCAGGTTGTGAGGGTAAGGTGGGCATGGCTGCTGTGCAG
NM_012254.2       AACGTGTATGGCGTGTGCGTGCCAGGTTGTGAGGGTAAGGTGGGCATGGCTGCTGTGCAG
                  ************************************************************

HsCD00080305      CTAGCCCCCGGCCAGACTTTCGACGGGGAGAAGTTGTACCAGCACGTTCGCGCTTGGCTC
NM_012254.2       CTAGCCCCCGGCCAGACTTTCGACGGGGAGAAGTTGTACCAGCACGTTCGCGCTTGGCTC
                  ************************************************************

HsCD00080305      CCTGCCTACGCTACCCCCCATTTCATCCGCATCCAGGACGCCATGGAGGTCACCAGCACG
NM_012254.2       CCTGCCTACGCTACCCCCCATTTCATCCGCATCCAGGACGCCATGGAGGTCACCAGCACG
                  ************************************************************

HsCD00080305      TTCAAACTGATGAAGACCCGGTTGGTGCGTGAGGGCTTCAATGTGGGGATCGTGGTTGAC
NM_012254.2       TTCAAACTGATGAAGACCCGGTTGGTGCGTGAGGGCTTCAATGTGGGGATCGTGGTTGAC
                  ************************************************************

HsCD00080305      CCTCTGTTTGTACTGGACAACCGGGCCCAGTCCTTCCGGCCCCTGACGGCAGAAATGTAC
NM_012254.2       CCTCTGTTTGTACTGGACAACCGGGCCCAGTCCTTCCGGCCCCTGACGGCAGAAATGTAC
                  ************************************************************

HsCD00080305      CAGGCTGTGTGTGAGGGAACCTGGAGGCTC---
NM_012254.2       CAGGCTGTGTGTGAGGGAACCTGGAGGCTCTGA
                  ******************************   

Pathways

Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Recycling of bile acids and salts
Reactome : Synthesis of bile acids and bile salts
Reactome : Synthesis of bile acids and bile salts via 24-hydroxycholesterol
Reactome : Synthesis of bile acids and bile salts via 7alpha-hydroxycholesterol

Protein

UniProt : Q9Y2P5
HPRD : 04499

Clone

Cloning Information : 264925
HIP Master Clone ID : 197023
IMAGE ID : 100015134
Original Clone ID : FLH264925.01L

Organism


TAX_ID : 9606
Species Specific ID: 10998

Genome

Chromosome : 19
Map Location : 19q13.43
Ensembl : ENSG00000083807

Reagents

Labome : SLC27A5-antibody