DNASU Plasmid Repository • 480.965.5697 | Email

HDAC2 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HDAC2
Gene Name:  histone deacetylase 2
Sequence             
Original Clone ID: FLH265083.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 24441677
Title: Class I HDACs are mediators of smoke-carcinogen induced stabilization of DNMT1 and serve as promising targets for chemoprevention of lung cancer
Authors: The ORFeome Collaboration
HsCD00080462

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1746nts         Open reading frame : 1 to 1746

ATGCGCTCACCTCCCTGCGGCCTCCTGAGGTGGTTTGGTGGCCCCCTCCTCGCGAGTTGG
TGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTACCGAGCCTTC
CCGGCGCCCCCTCCTCTCCTCCCACCGGCCTGCCCTTCCCCGCGGGACTATCGCCCCCAC
GTTTCCCTCAGCCCTTTTCTCTCCCGGCCGAGCCGCGGCGGCAGCAGCAGCAGCAGCAGC
AGCAGGAGGAGGAGCCCGGTGGCGGCGGTGGCCGGGGAGCCCATGGCGTACAGTCAAGGA
GGCGGCAAAAAAAAAGTCTGCTACTACTACGACGGTGATATTGGAAATTATTATTATGGA
CAGGGTCATCCCATGAAGCCTCATAGAATCCGCATGACCCATAACTTGCTGTTAAATTAT
GGCTTATACAGAAAAATGGAAATATATAGGCCCCATAAAGCCACTGCCGAAGAAATGACA
AAATATCACAGTGATGAGTATATCAAATTTCTACGGTCAATAAGACCAGATAACATGTCT
GAGTATAGTAAGCAGATGCAGAGATTTAATGTTGGAGAAGATTGTCCAGTGTTTGATGGA
CTCTTTGAGTTTTGTCAGCTCTCAACTGGCGGTTCAGTTGCTGGAGCTGTGAAGTTAAAC
CGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCA
GAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAG
TATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAA
GCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTT
CCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAAT
TTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATC
TCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGACTCA
TTATCTGGTGATAGACTGGGTTGTTTCAATCTAACAGTCAAAGGTCATGCTAAATGTGTA
GAAGTTGTAAAAACTTTTAACTTACCATTACTGATGCTTGGAGGAGGTGGCTACACAATC
CGTAATGTTGCTCGATGTTGGACATATGAGACTGCAGTTGCCCTTGATTGTGAGATTCCC
AATGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCAGACTTCAAACTGCATATT
AGTCCTTCAAACATGACAAACCAGAACACTCCAGAATATATGGAAAAGATAAAACAGCGT
TTGTTTGAAAATTTGCGCATGTTACCTCATGCACCTGGTGTCCAGATGCAAGCTATTCCA
GAAGATGCTGTTCATGAAGACAGTGGAGATGAAGATGGAGAAGATCCAGACAAGAGAATT
TCTATTCGAGCATCAGACAAGCGGATAGCTTGTGATGAAGAATTCTCAGATTCTGAGGAT
GAAGGAGAAGGAGGTCGAAGAAATGTGGCTGATCATAAGAAAGGAGCAAAGAAAGCTAGA
ATTGAAGAAGATAAGAAAGAAACAGAGGACAAAAAAACAGACGTTAAGGAAGAAGATAAA
TCCAAGGACAACAGTGGTGAAAAAACAGATACCAAAGGAACCAAATCAGAACAGCTCAGC
AACCCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1749
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HDAC2
Symbol Nomenclature : HDAC2
SYNONYM : HD2; RPD3; YAF1
Designation : YY1-associated factor 1|transcriptional regulator homolog RPD3
Full Nomenclature : histone deacetylase 2
GENEID : 3066
GI : 148922186
GenBank Accession : BC146376
HGNC : 4853
MIM : 605164
Target GenBank: NM_001527

 

Pathways

NCI : Direct p53 effectors
NCI : Glucocorticoid receptor regulatory network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Signaling events mediated by HDAC Class I
Panther : Wnt signaling pathway
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Disease
Reactome : Epigenetic regulation of gene expression
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signalling by NGF
Reactome : Transcription
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR negatively regulates cell cycle via SC1
WikiPathway : Cell cycle
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway

Protein

UniProt : Q92769
HPRD : 05521

Clone

Cloning Information : 265083
HIP Master Clone ID : 197181
IMAGE ID : 100015085
Original Clone ID : FLH265083.01L

Organism


TAX_ID : 9606
Species Specific ID: 3066

Genome

Chromosome : 6
Map Location : 6q21
Ensembl : ENSG00000196591

Reagents

Labome : HDAC2-antibody