DNASU Plasmid Repository • 480.965.5697 | Email

UL48 (Human alphaherpesvirus 1) in MV14

TOP

Explanation of Terms


Gene: Gene Symbol:  UL48
Gene Name:  transactivates immediate early genes; involved in gene regulation; involved in virion morphogenesis, Herpes simplex virus protein vmw65 tetramer
Sequence             
Original Clone ID: None
Keyword: Cloned using restriction enzymes, XbaI and NotI, in fusion with mCherry
Species: Human alphaherpesvirus 1
Type: cDNA
Vector Name: MV14               Format:  FUSION
Source: Karmella Haynes
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Arizona State University
Rene Daer
Karmella Haynes
Cassandra Barrett
HaCD00812388

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 150nts         Open reading frame : 1 to 150

GACGCTTTGGACGACTTCGACTTGGACATGTTGGGTTCTGACGCTTTGGACGACTTCGAC
TTGGACATGTTGGGTTCTGACGCTTTGGACGACTTCGACTTGGACATGTTGGGTTCTGAC
GCTTTGGACGACTTCGACTTGGACATGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verified by Clone submitter
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCTAGA

3' Linker Sequence:
GCGGCCGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: MV14

MV14 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  DD122B
Reverse:  DD123B
Description: fluorescent marker assay, multiple cloning site clone, mammalian expression expression with AmpR and CMV and Gal4 Act and mCherry and F1 origin and NotI and XbaI and SV40 and PuroR; puromycin resistance in mammalian, ampicillin resistance in bacterial;
Comments: This vector is pRL-CMV modified by addition of a ccdB death cassette to make it compatible with the Gateway system.
Size (bp): 6362
Parent Vector: None
Empty Vector: None
Properties: fluorescent marker, mammalian expression, multiple cloning site
Author Name: Karmella Haynes
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
Gene mCherry 2127 2831
Miscellaneous Feature NotI NotI Cut Site 2866 2873
Miscellaneous Feature XbaI XbaI Cut Site 2832 2837
Origin F1 origin 3251 3557
binding site Gal4 Act Gal4 DNA Binding Domain 1662 2102
enhancer SV40 SV40 Enhancer 3677 3892
promoter CMV 1025 1624
selectable marker AmpR 9 653
selectable marker PuroR 4015 4614

 

  • Gene
  • Clone
  • Organism

Gene

Target GenBank: YP_009137123.1

 

Clone

Cloning Information : 909160

Organism


Species Specific ID: 24271473