DNASU Plasmid Repository • 480.965.5697 | Email

RFP-VP64 (fusion) (Recombinant) in MV2

TOP

Explanation of Terms


Gene: Gene Symbol:  RFP-VP64 (fusion)
Gene Name:  N-terminal-truncated variant of a synthetic Polycomb transcription factor for control experiments
Sequence             
Original Clone ID: None
Keyword: Vector map has been attached to file. Insert begins with Tet promoter followed by a Kozac sequence. Coding region begins with the part mCherry (a red fluorescent protein acting as a reporter gene), and then followed by VP64, a tetrameric r
Species: Recombinant
Type: cDNA
Vector Name: MV2               Format:  CLOSED
Source: Karmella Haynes
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 21669865
Title: Synthetic reversal of epigenetic silencing.
Authors: Arizona State University
Karmella Haynes
Pamela Silver
ReCD00812742

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 936nts         Open reading frame : 746 to 1681

GTTGACATTGATTATTGGCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA
GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC
CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG
GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC
ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG
CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG
TATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGAT
AGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGT
TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGC
AAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCCCTATCAGTG
ATAGAGATCTCCCTATCAGTGATAGAGATCGTCGACGAGCTCGTTTAGTGAACCGTCAGA
TCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCA
GCCTCCGACTAGACCCGCCGCCACCATGGAGACTAGAGTGAGCAAGGGCGAGGAGGATAA
CATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGG
CCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGC
CAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCA
GTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAA
GCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGT
GGTGACCGTGACCCAGGACTCCTCCTTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCT
GCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGA
GGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAG
GCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAA
GAAGCCCGTGCAGCTACCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCA
CAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGG
CGGCATGGACGAGCTGTACAAGACTAGAGACGCTTTGGACGACTTCGACTTGGACATGTT
GGGTTCTGACGCTTTGGACGACTTCGACTTGGACATGTTGGGTTCTGACGCTTTGGACGA
CTTCGACTTGGACATGTTGGGTTCTGACGCTTTGGACGACTTCGACTTGGACATGTTGAC
TAGACCCAAGAAAAAGCGCAAGGTAGAACAAAAACTCATCTCAGAAGAGGATCTGGCGTA
AAGCTGAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verified by Clone submitter
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GAATTCGCGGCCGCTTCTAGA

3' Linker Sequence:
ACTAGTAGCGGCCGCTGCAG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: MV2

MV2 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  DD122B
Reverse:  DD123B
Description: fluorescent marker assay, multiple cloning site clone, mammalian expression expression with AmpR and DD123B and DD122B and F1 origin and SV40 and PuroR and lac and SpeI; ampicillin resistance in bacterial, puromycin resistance in mammalian;
Comments: This vector is pRL-CMV modified by addition of a ccdB death cassette to make it compatible with the Gateway system.
Size (bp): 4521
Parent Vector: None
Empty Vector: None
Properties: fluorescent marker, mammalian expression, multiple cloning site
Author Name: Karmella Haynes
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
Miscellaneous Feature SpeI SpeI Cut Site 18 23
Origin F1 origin 390 696
enhancer SV40 816 1031
primer DD122B 5' Sequencing Primer - gttaggcgttttgcgctg 4476 4493
primer DD123B Sequencing Primer - gctggcaactagaaggcac 105 123
promoter lac 2185 2214
selectable marker AmpR 3294 4154
selectable marker PuroR Puromycin Resistance 1154 1753

 

  • Clone

Clone

Cloning Information : 910177