DNASU Plasmid Repository • 480.965.5697 | Email

ADCY8 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ADCY8
Gene Name:  adenylate cyclase 8 (brain)
Sequence             
Original Clone ID: FLH267391.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082614

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3753nts         Open reading frame : 1 to 3753
Reference Sequence Alignment

ATGGAGCTCTCCGATGTGCGCTGCCTTACAGGCAGCGAGGAACTCTACACCATCCACCCG
ACGCCCCCGGCCGGCGACGGCAGGAGCGCCTCCCGGCCGCAGCGGCTGCTGTGGCAGACG
GCGGTGCGACACATCACGGAGCAGCGCTTCATTCACGGGCACCGGGGAGGCAGCGGCAGC
GGGAGTGGAGGCTCGGGCAAAGCCTCGGACCCTGCGGGCGGCGGCCCCAACCACCACGCG
CCGCAGCTGTCAGGCGACTCGGCGCTGCCCCTCTACTCGCTGGGCCCGGGAGAGCGAGCG
CACAGCACCTGCGGCACCAAAGTCTTCCCGGAACGCAGCGGGAGCGGCAGTGCCAGCGGC
AGCGGAGGCGGGGGCGACCTGGGCTTCCTGCACCTTGACTGTGCCCCTAGCAACTCGGAT
TTCTTTCTTAATGGGGGCTATAGCTACCGAGGGGTCATTTTCCCCACCCTGCGCAACTCC
TTCAAATCTCGGGATTTGGAACGCCTCTACCAGCGCTATTTCTTGGGCCAAAGGCGCAAA
TCGGAAGTGGTGATGAACGTGCTGGACGTGCTGACCAAACTCACTCTCTTGGTCCTACAC
TTGAGCCTGGCCTCGGCCCCCATGGACCCGCTCAAGGGCATCCTGCTGGGCTTCTTCACC
GGCATTGAGGTAGTGATCTGCGCCCTGGTGGTGGTCAGGAAGGACACCACCTCCCACACG
TACCTGCAGTACAGCGGCGTGGTCACCTGGGTGGCCATGACCACCCAGATCCTGGCAGCA
GGCCTCGGCTACGGGCTCCTGGGCGACGGCATAGGCTACGTGCTCTTCACGCTCTTCGCC
ACCTACAGTATGCTGCCGCTGCCGCTCACCTGGGCCATCCTGGCCGGCCTGGGCACCTCG
CTGCTGCAGGTCATCCTCCAAGTGGTCATACCCCGGCTGGCGGTCATTTCCATCAACCAG
GTTGTGGCCCAGGCAGTGCTATTCATGTGTATGAACACAGCTGGAATCTTCATCAGTTAC
CTGTCAGACCGGGCCCAGCGCCAAGCTTTCCTGGAGACTCGGAGGTGTGTGGAGGCCAGG
CTGCGCCTGGAGACAGAGAACCAAAGACAGGAGCGGCTCGTGCTTTCTGTGCTCCCCCGG
TTTGTTGTCCTGGAAATGATCAACGACATGACCAATGTGGAAGATGAGCACCTGCAGCAC
CAGTTCCATCGGATCTACATCCATCGCTATGAGAACGTCAGTATTCTTTTTGCAGATGTT
AAAGGATTTACCAACCTCTCCACGACCTTGTCTGCTCAGGAGCTGGTCAGGATGCTCAAC
GAGCTCTTTGCCAGATTTGATCGACTGGCCCATGAGCATCACTGCCTTCGTATTAAAATC
CTGGGGGACTGCTACTACTGCGTGTCTGGACTTCCTGAGCCCCGCCAGGACCATGCCCAC
TGCTGTGTTGAAATGGGTCTCAGCATGATCAAAACCATCAGGTATGTGCGGTCAAGGACA
AAACACGATGTTGACATGAGGATTGGAATCCACTCCGGCTCGGTGCTGTGCGGTGTTTTG
GGACTAAGGAAGTGGCAGTTTGATGTCTGGTCTTGGGATGTGGATATTGCAAACAAACTC
GAATCTGGAGGAATCCCTGGGAGGATTCACATTTCCAAAGCCACGCTGGACTGTCTCAAC
GGTGACTATAACGTGGAAGAGGGCCATGGTAAAGAGAGGAATGAATTCCTGAGGAAGCAT
AATATCGAAACTTACTTAATTAAGCAGCCTGAGGACAGTCTGCTGTCCTTGCCTGAAGAT
ATCGTCAAGGAGTCAGTGAGCTCCTCAGACCGGAGAAACAGTGGGGCCACATTCACTGAA
GGATCCTGGAGCCCTGAACTGCCCTTTGATAATATCGTGGGGAAACAGAATACTCTGGCT
GCCCTAACAAGAAATTCAATAAATCTGCTTCCAAACCATCTTGCACAAGCTTTGCATGTC
CAGTCTGGGCCTGAGGAAATTAACAAGAGAATAGAACATACCATCGACTTGCGGAGTGGC
GATAAATTGAGAAGAGAGCATATCAAGCCATTCTCACTGATGTTTAAAGACTCCAGCCTG
GAGCACAAGTATTCTCAAATGAGGGATGAAGTGTTCAAGTCAAACTTGGTCTGTGCATTT
ATCGTTCTTCTATTTATCACGGCAATACAAAGTTTGCTTCCTTCTTCAAGAGTGATGCCA
ATGACCATCCAGTTCTCCATTCTGATTATGCTGCACTCGGCTCTGGTCCTCATCACCACA
GCAGAGGATTATAAATGTTTGCCCCTCATCCTCCGGAAAACTTGCTGTTGGATTAATGAG
ACCTATTTGGCCCGGAACGTCATCATCTTTGCATCCATTTTGATTAATTTCCTGGGTGCC
ATCTTAAATATCCTGTGGTGTGATTTTGACAAGTCGATACCCTTGAAGAACCTGACTTTC
AATTCCTCAGCTGTGTTTACAGATATCTGCTCCTACCCAGAGTACTTTGTCTTCACGGGG
GTGTTGGCCATGGTGACCTGTGCAGTTTTCCTCCGGCTGAACTCCGTCCTGAAGCTGGCA
GTGCTGCTGATCATGATTGCCATCTATGCCCTGCTCACTGAGACCGTCTACGCAGGCCTC
TTTCTGCGTTATGACAACCTCAACCACAGTGGAGAAGATTTCCTGGGGACCAAGGAGGTA
TCACTGCTACTGATGGCCATGTTCCTCCTGGCTGTGTTCTACCATGGACAGCAGCTGGAG
TACACAGCCCGCCTGGACTTCCTTTGGCGAGTACAGGCCAAAGAGGAGATCAATGAGATG
AAGGAGCTGAGGGAACACAATGAGAACATGCTCCGGAATATCTTACCCAGCCATGTGGCC
CGCCATTTCCTAGAGAAGGACCGAGACAATGAGGAGCTGTATTCTCAATCCTATGATGCT
GTTGGGGTGATGTTTGCCTCCATCCCAGGATTTGCGGACTTTTACTCTCAGACTGAAATG
AATAACCAGGGAGTGGAATGCCTGCGCTTGCTCAATGAGATCATTGCTGACTTCGATGAG
TTGCTTGGTGAAGACCGATTTCAAGACATTGAAAAGATTAAGACCATTGGCAGCACCTAC
ATGGCCGTGTCAGGCCTGTCACCTGAAAAACAGCAATGTGAAGACAAGTGGGGACATTTG
TGTGCTCTGGCTGACTTCTCACTCGCCCTGACAGAAAGCATACAGGAGATCAACAAGCAT
TCATTCAACAATTTTGAACTCCGGATTGGCATCAGCCACGGCTCAGTGGTAGCTGGCGTT
ATCGGCGCTAAGAAACCACAGTATGACATTTGGGGCAAAACTGTGAACCTGGCAAGCCGA
ATGGACAGCACGGGGGTTAGTGGCCGGATCCAAGTCCCAGAGGAGACCTATCTCATCCTG
AAGGACCAGGGCTTTGCCTTTGATTACCGAGGGGAGATCTATGTGAAGGGTATCAGTGAA
CAGGAAGGAAAAATCAAAACGTACTTTCTTCTGGGAAGAGTCCAACCCAACCCATTCATC
TTGCCCCCAAGAAGACTGCCTGGGCAGTACTCCCTGGCCGCGGTTGTCCTGGGACTTGTC
CAGTCCCTCAATAGGCAAAGGCAGAAGCAGCTACTCAATGAGAACAACAACACAGGAATC
ATCAAGGGTCATTACAACCGGCGGACTTTGTTGTCACCCAGCGGCACAGAGCCTGGAGCC
CAGGCTGAAGGCACCGACAAATCTGATTTGCCA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3787
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
GGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ADCY8
Symbol Nomenclature : ADCY8
SYNONYM : AC8; ADCY3; HBAC1
Designation : ATP pyrophosphate-lyase 8|adenylate cyclase type 8|adenylate cyclase type VIII|adenylyl cyclase 8|adenylyl cyclase-8, brain|ca(2+)/calmodulin-activated adenylyl cyclase
Full Nomenclature : adenylate cyclase 8 (brain)
GENEID : 114
GI : 109939839
GenBank Accession : BC111456
HGNC : 239
MIM : 103070
Vega : OTTHUMG00000164756
Target GenBank: BC111456

 

Reference Sequence Alignment

  

HsCD00082614        ATGGAGCTCTCCGATGTGCGCTGCCTTACAGGCAGCGAGGAACTCTACACCATCCACCCG
XM_005250769.1      ATGGAGCTCTCCGATGTGCGCTGCCTTACAGGCAGCGAGGAACTCTACACCATCCACCCG
NM_001115.2         ATGGAGCTCTCCGATGTGCGCTGCCTTACAGGCAGCGAGGAACTCTACACCATCCACCCG
                    ************************************************************

HsCD00082614        ACGCCCCCGGCCGGCGACGGCAGGAGCGCCTCCCGGCCGCAGCGGCTGCTGTGGCAGACG
XM_005250769.1      ACGCCCCCGGCCGGCGACGGCAGGAGCGCCTCCCGGCCGCAGCGGCTGCTGTGGCAGACG
NM_001115.2         ACGCCCCCGGCCGGCGACGGCAGGAGCGCCTCCCGGCCGCAGCGGCTGCTGTGGCAGACG
                    ************************************************************

HsCD00082614        GCGGTGCGACACATCACGGAGCAGCGCTTCATTCACGGGCACCGGGGAGGCAGCGGCAGC
XM_005250769.1      GCGGTGCGACACATCACGGAGCAGCGCTTCATTCACGGGCACCGGGGAGGCAGCGGCAGC
NM_001115.2         GCGGTGCGACACATCACGGAGCAGCGCTTCATTCACGGGCACCGGGGAGGCAGCGGCAGC
                    ************************************************************

HsCD00082614        GGGAGTGGAGGCTCGGGCAAAGCCTCGGACCCTGCGGGCGGCGGCCCCAACCACCACGCG
XM_005250769.1      GGGAGTGGAGGCTCGGGCAAAGCCTCGGACCCTGCGGGCGGCGGCCCCAACCACCACGCG
NM_001115.2         GGGAGTGGAGGCTCGGGCAAAGCCTCGGACCCTGCGGGCGGCGGCCCCAACCACCACGCG
                    ************************************************************

HsCD00082614        CCGCAGCTGTCAGGCGACTCGGCGCTGCCCCTCTACTCGCTGGGCCCGGGAGAGCGAGCG
XM_005250769.1      CCGCAGCTGTCAGGCGACTCGGCGCTGCCCCTCTACTCGCTGGGCCCGGGAGAGCGAGCG
NM_001115.2         CCGCAGCTGTCAGGCGACTCGGCGCTGCCCCTCTACTCGCTGGGCCCGGGAGAGCGAGCG
                    ************************************************************

HsCD00082614        CACAGCACCTGCGGCACCAAAGTCTTCCCGGAACGCAGCGGGAGCGGCAGTGCCAGCGGC
XM_005250769.1      CACAGCACCTGCGGCACCAAAGTCTTCCCGGAACGCAGCGGGAGCGGCAGTGCCAGCGGC
NM_001115.2         CACAGCACCTGCGGCACCAAAGTCTTCCCGGAACGCAGCGGGAGCGGCAGTGCCAGCGGC
                    ************************************************************

HsCD00082614        AGCGGAGGCGGGGGCGACCTGGGCTTCCTGCACCTTGACTGTGCCCCTAGCAACTCGGAT
XM_005250769.1      AGCGGAGGCGGGGGCGACCTGGGCTTCCTGCACCTTGACTGTGCCCCTAGCAACTCGGAT
NM_001115.2         AGCGGAGGCGGGGGCGACCTGGGCTTCCTGCACCTTGACTGTGCCCCTAGCAACTCGGAT
                    ************************************************************

HsCD00082614        TTCTTTCTTAATGGGGGCTATAGCTACCGAGGGGTCATTTTCCCCACCCTGCGCAACTCC
XM_005250769.1      TTCTTTCTTAATGGGGGCTATAGCTACCGAGGGGTCATTTTCCCCACCCTGCGCAACTCC
NM_001115.2         TTCTTTCTTAATGGGGGCTATAGCTACCGAGGGGTCATTTTCCCCACCCTGCGCAACTCC
                    ************************************************************

HsCD00082614        TTCAAATCTCGGGATTTGGAACGCCTCTACCAGCGCTATTTCTTGGGCCAAAGGCGCAAA
XM_005250769.1      TTCAAATCTCGGGATTTGGAACGCCTCTACCAGCGCTATTTCTTGGGCCAAAGGCGCAAA
NM_001115.2         TTCAAATCTCGGGATTTGGAACGCCTCTACCAGCGCTATTTCTTGGGCCAAAGGCGCAAA
                    ************************************************************

HsCD00082614        TCGGAAGTGGTGATGAACGTGCTGGACGTGCTGACCAAACTCACTCTCTTGGTCCTACAC
XM_005250769.1      TCGGAAGTGGTGATGAACGTGCTGGACGTGCTGACCAAACTCACTCTCTTGGTCCTACAC
NM_001115.2         TCGGAAGTGGTGATGAACGTGCTGGACGTGCTGACCAAACTCACTCTCTTGGTCCTACAC
                    ************************************************************

HsCD00082614        TTGAGCCTGGCCTCGGCCCCCATGGACCCGCTCAAGGGCATCCTGCTGGGCTTCTTCACC
XM_005250769.1      TTGAGCCTGGCCTCGGCCCCCATGGACCCGCTCAAGGGCATCCTGCTGGGCTTCTTCACC
NM_001115.2         TTGAGCCTGGCCTCGGCCCCCATGGACCCGCTCAAGGGCATCCTGCTGGGCTTCTTCACC
                    ************************************************************

HsCD00082614        GGCATTGAGGTAGTGATCTGCGCCCTGGTGGTGGTCAGGAAGGACACCACCTCCCACACG
XM_005250769.1      GGCATTGAGGTAGTGATCTGCGCCCTGGTGGTGGTCAGGAAGGACACCACCTCCCACACG
NM_001115.2         GGCATTGAGGTAGTGATCTGCGCCCTGGTGGTGGTCAGGAAGGACACCACCTCCCACACG
                    ************************************************************

HsCD00082614        TACCTGCAGTACAGCGGCGTGGTCACCTGGGTGGCCATGACCACCCAGATCCTGGCAGCA
XM_005250769.1      TACCTGCAGTACAGCGGCGTGGTCACCTGGGTGGCCATGACCACCCAGATCCTGGCAGCA
NM_001115.2         TACCTGCAGTACAGCGGCGTGGTCACCTGGGTGGCCATGACCACCCAGATCCTGGCAGCA
                    ************************************************************

HsCD00082614        GGCCTCGGCTACGGGCTCCTGGGCGACGGCATAGGCTACGTGCTCTTCACGCTCTTCGCC
XM_005250769.1      GGCCTCGGCTACGGGCTCCTGGGCGACGGCATAGGCTACGTGCTCTTCACGCTCTTCGCC
NM_001115.2         GGCCTCGGCTACGGGCTCCTGGGCGACGGCATAGGCTACGTGCTCTTCACGCTCTTCGCC
                    ************************************************************

HsCD00082614        ACCTACAGTATGCTGCCGCTGCCGCTCACCTGGGCCATCCTGGCCGGCCTGGGCACCTCG
XM_005250769.1      ACCTACAGTATGCTGCCGCTGCCGCTCACCTGGGCCATCCTGGCCGGCCTGGGCACCTCG
NM_001115.2         ACCTACAGTATGCTGCCGCTGCCGCTCACCTGGGCCATCCTGGCCGGCCTGGGCACCTCG
                    ************************************************************

HsCD00082614        CTGCTGCAGGTCATCCTCCAAGTGGTCATACCCCGGCTGGCGGTCATTTCCATCAACCAG
XM_005250769.1      CTGCTGCAGGTCATCCTCCAAGTGGTCATACCCCGGCTGGCGGTCATTTCCATCAACCAG
NM_001115.2         CTGCTGCAGGTCATCCTCCAAGTGGTCATACCCCGGCTGGCGGTCATTTCCATCAACCAG
                    ************************************************************

HsCD00082614        GTTGTGGCCCAGGCAGTGCTATTCATGTGTATGAACACAGCTGGAATCTTCATCAGTTAC
XM_005250769.1      GTTGTGGCCCAGGCAGTGCTATTCATGTGTATGAACACAGCTGGAATCTTCATCAGTTAC
NM_001115.2         GTTGTGGCCCAGGCAGTGCTATTCATGTGTATGAACACAGCTGGAATCTTCATCAGTTAC
                    ************************************************************

HsCD00082614        CTGTCAGACCGGGCCCAGCGCCAAGCTTTCCTGGAGACTCGGAGGTGTGTGGAGGCCAGG
XM_005250769.1      CTGTCAGACCGGGCCCAGCGCCAAGCTTTCCTGGAGACTCGGAGGTGTGTGGAGGCCAGG
NM_001115.2         CTGTCAGACCGGGCCCAGCGCCAAGCTTTCCTGGAGACTCGGAGGTGTGTGGAGGCCAGG
                    ************************************************************

HsCD00082614        CTGCGCCTGGAGACAGAGAACCAAAGACAGGAGCGGCTCGTGCTTTCTGTGCTCCCCCGG
XM_005250769.1      CTGCGCCTGGAGACAGAGAACCAAAGACAGGAGCGGCTCGTGCTTTCTGTGCTCCCCCGG
NM_001115.2         CTGCGCCTGGAGACAGAGAACCAAAGACAGGAGCGGCTCGTGCTTTCTGTGCTCCCCCGG
                    ************************************************************

HsCD00082614        TTTGTTGTCCTGGAAATGATCAACGACATGACCAATGTGGAAGATGAGCACCTGCAGCAC
XM_005250769.1      TTTGTTGTCCTGGAAATGATCAACGACATGACCAATGTGGAAGATGAGCACCTGCAGCAC
NM_001115.2         TTTGTTGTCCTGGAAATGATCAACGACATGACCAATGTGGAAGATGAGCACCTGCAGCAC
                    ************************************************************

HsCD00082614        CAGTTCCATCGGATCTACATCCATCGCTATGAGAACGTCAGTATTCTTTTTGCAGATGTT
XM_005250769.1      CAGTTCCATCGGATCTACATCCATCGCTATGAGAACGTCAGTATTCTTTTTGCAGATGTT
NM_001115.2         CAGTTCCATCGGATCTACATCCATCGCTATGAGAACGTCAGTATTCTTTTTGCAGATGTT
                    ************************************************************

HsCD00082614        AAAGGATTTACCAACCTCTCCACGACCTTGTCTGCTCAGGAGCTGGTCAGGATGCTCAAC
XM_005250769.1      AAAGGATTTACCAACCTCTCCACGACCTTGTCTGCTCAGGAGCTGGTCAGGATGCTCAAC
NM_001115.2         AAAGGATTTACCAACCTCTCCACGACCTTGTCTGCTCAGGAGCTGGTCAGGATGCTCAAC
                    ************************************************************

HsCD00082614        GAGCTCTTTGCCAGATTTGATCGACTGGCCCATGAGCATCACTGCCTTCGTATTAAAATC
XM_005250769.1      GAGCTCTTTGCCAGATTTGATCGACTGGCCCATGAGCATCACTGCCTTCGTATTAAAATC
NM_001115.2         GAGCTCTTTGCCAGATTTGATCGACTGGCCCATGAGCATCACTGCCTTCGTATTAAAATC
                    ************************************************************

HsCD00082614        CTGGGGGACTGCTACTACTGCGTGTCTGGACTTCCTGAGCCCCGCCAGGACCATGCCCAC
XM_005250769.1      CTGGGGGACTGCTACTACTGCGTGTCTGGACTTCCTGAGCCCCGCCAGGACCATGCCCAC
NM_001115.2         CTGGGGGACTGCTACTACTGCGTGTCTGGACTTCCTGAGCCCCGCCAGGACCATGCCCAC
                    ************************************************************

HsCD00082614        TGCTGTGTTGAAATGGGTCTCAGCATGATCAAAACCATCAGGTATGTGCGGTCAAGGACA
XM_005250769.1      TGCTGTGTTGAAATGGGTCTCAGCATGATCAAAACCATCAGGTATGTGCGGTCAAGGACA
NM_001115.2         TGCTGTGTTGAAATGGGTCTCAGCATGATCAAAACCATCAGGTATGTGCGGTCAAGGACA
                    ************************************************************

HsCD00082614        AAACACGATGTTGACATGAGGATTGGAATCCACTCCGGCTCGGTGCTGTGCGGTGTTTTG
XM_005250769.1      AAACACGATGTTGACATGAGGATTGGAATCCACTCCGGCTCGGTGCTGTGCGGTGTTTTG
NM_001115.2         AAACACGATGTTGACATGAGGATTGGAATCCACTCCGGCTCGGTGCTGTGCGGTGTTTTG
                    ************************************************************

HsCD00082614        GGACTAAGGAAGTGGCAGTTTGATGTCTGGTCTTGGGATGTGGATATTGCAAACAAACTC
XM_005250769.1      GGACTAAGGAAGTGGCAGTTTGATGTCTGGTCTTGGGATGTGGATATTGCAAACAAACTC
NM_001115.2         GGACTAAGGAAGTGGCAGTTTGATGTCTGGTCTTGGGATGTGGATATTGCAAACAAACTC
                    ************************************************************

HsCD00082614        GAATCTGGAGGAATCCCTGGGAGGATTCACATTTCCAAAGCCACGCTGGACTGTCTCAAC
XM_005250769.1      GAATCTGGAGGAATCCCTGGGAGGATTCACATTTCCAAAGCCACGCTGGACTGTCTCAAC
NM_001115.2         GAATCTGGAGGAATCCCTGGGAGGATTCACATTTCCAAAGCCACGCTGGACTGTCTCAAC
                    ************************************************************

HsCD00082614        GGTGACTATAACGTGGAAGAGGGCCATGGTAAAGAGAGGAATGAATTCCTGAGGAAGCAT
XM_005250769.1      GGTGACTATAACGTGGAAGAGGGCCATGGTAAAGAGAGGAATGAATTCCTGAGGAAGCAT
NM_001115.2         GGTGACTATAACGTGGAAGAGGGCCATGGTAAAGAGAGGAATGAATTCCTGAGGAAGCAT
                    ************************************************************

HsCD00082614        AATATCGAAACTTACTTAATTAAGCAGCCTGAGGACAGTCTGCTGTCCTTGCCTGAAGAT
XM_005250769.1      AATATCGAAACTTACTTAATTAAGCAGCCTGAGGACAGTCTGCTGTCCTTGCCTGAAGAT
NM_001115.2         AATATCGAAACTTACTTAATTAAGCAGCCTGAGGACAGTCTGCTGTCCTTGCCTGAAGAT
                    ************************************************************

HsCD00082614        ATCGTCAAGGAGTCAGTGAGCTCCTCAGACCGGAGAAACAGTGGGGCCACATTCACTGAA
XM_005250769.1      ATCGTCAAGGAGTCAGTGAGCTCCTCAGACCGGAGAAACAGTGGGGCCACATTCACTGAA
NM_001115.2         ATCGTCAAGGAGTCAGTGAGCTCCTCAGACCGGAGAAACAGTGGGGCCACATTCACTGAA
                    ************************************************************

HsCD00082614        GGATCCTGGAGCCCTGAACTGCCCTTTGATAATATCGTGGGGAAACAGAATACTCTGGCT
XM_005250769.1      GGATCCTGGAGCCCTGAACTGCCCTTTGATAATATCGTGGGGAAACAGAATACTCTGGCT
NM_001115.2         GGATCCTGGAGCCCTGAACTGCCCTTTGATAATATCGTGGGGAAACAGAATACTCTGGCT
                    ************************************************************

HsCD00082614        GCCCTAACAAGAAATTCAATAAATCTGCTTCCAAACCATCTTGCACAAGCTTTGCATGTC
XM_005250769.1      GCCCTAACAAGAAATTCAATAAATCTGCTTCCAAACCATCTTGCACAAGCTTTGCATGTC
NM_001115.2         GCCCTAACAAGAAATTCAATAAATCTGCTTCCAAACCATCTTGCACAAGCTTTGCATGTC
                    ************************************************************

HsCD00082614        CAGTCTGGGCCTGAGGAAATTAACAAGAGAATAGAACATACCATCGACTTGCGGAGTGGC
XM_005250769.1      CAGTCTGGGCCTGAGGAAATTAACAAGAGAATAGAACATACCATCGACTTGCGGAGTGGC
NM_001115.2         CAGTCTGGGCCTGAGGAAATTAACAAGAGAATAGAACATACCATCGACTTGCGGAGTGGC
                    ************************************************************

HsCD00082614        GATAAATTGAGAAGAGAGCATATCAAGCCATTCTCACTGATGTTTAAAGACTCCAGCCTG
XM_005250769.1      GATAAATTGAGAAGAGAGCATATCAAGCCATTCTCACTGATGTTTAAAGACTCCAGCCTG
NM_001115.2         GATAAATTGAGAAGAGAGCATATCAAGCCATTCTCACTGATGTTTAAAGACTCCAGCCTG
                    ************************************************************

HsCD00082614        GAGCACAAGTATTCTCAAATGAGGGATGAAGTGTTCAAGTCAAACTTGGTCTGTGCATTT
XM_005250769.1      GAGCACAAGTATTCTCAAATGAGGGATGAAGTGTTCAAGTCAAACTTGGTCTGTGCATTT
NM_001115.2         GAGCACAAGTATTCTCAAATGAGGGATGAAGTGTTCAAGTCAAACTTGGTCTGTGCATTT
                    ************************************************************

HsCD00082614        ATCGTTCTTCTATTTATCACGGCAATACAAAGTTTGCTTCCTTCTTCAAGAGTGATGCCA
XM_005250769.1      ATCGTTCTTCTATTTATCACGGCAATACAAAGTTTGCTTCCTTCTTCAAGAGTGATGCCA
NM_001115.2         ATCGTTCTTCTATTTATCACGGCAATACAAAGTTTGCTTCCTTCTTCAAGAGTGATGCCA
                    ************************************************************

HsCD00082614        ATGACCATCCAGTTCTCCATTCTGATTATGCTGCACTCGGCTCTGGTCCTCATCACCACA
XM_005250769.1      ATGACCATCCAGTTCTCCATTCTGATTATGCTGCACTCGGCTCTGGTCCTCATCACCACA
NM_001115.2         ATGACCATCCAGTTCTCCATTCTGATTATGCTGCACTCGGCTCTGGTCCTCATCACCACA
                    ************************************************************

HsCD00082614        GCAGAGGATTATAAATGTTTGCCCCTCATCCTCCGGAAAACTTGCTGTTGGATTAATGAG
XM_005250769.1      GCAGAGGATTATAAATGTTTGCCCCTCATCCTCCGGAAAACTTGCTGTTGGATTAATGAG
NM_001115.2         GCAGAGGATTATAAATGTTTGCCCCTCATCCTCCGGAAAACTTGCTGTTGGATTAATGAG
                    ************************************************************

HsCD00082614        ACCTATTTGGCCCGGAACGTCATCATCTTTGCATCCATTTTGATTAATTTCCTGGGTGCC
XM_005250769.1      ACCTATTTGGCCCGGAACGTCATCATCTTTGCATCCATTTTGATTAATTTCCTGGGTGCC
NM_001115.2         ACCTATTTGGCCCGGAACGTCATCATCTTTGCATCCATTTTGATTAATTTCCTGGGTGCC
                    ************************************************************

HsCD00082614        ATCTTAAATATCCTGTGGTGTGATTTTGACAAGTCGATACCCTTGAAGAACCTGACTTTC
XM_005250769.1      ATCTTAAATATCTACTTTG-----------------------------------------
NM_001115.2         ATCTTAAATATCCTGTGGTGTGATTTTGACAAGTCGATACCCTTGAAGAACCTGACTTTC
                    ************ : *                                            

HsCD00082614        AATTCCTCAGCTGTGTTTACAGATATCTGCTCCTACCCAGAGTACTTTGTCTTCACGGGG
XM_005250769.1      -------------------------------------------------TCTTCACGGGG
NM_001115.2         AATTCCTCAGCTGTGTTTACAGATATCTGCTCCTACCCAGAGTACTTTGTCTTCACGGGG
                                                                     ***********

HsCD00082614        GTGTTGGCCATGGTGACCTGTGCAGTTTTCCTCCGGCTGAACTCCGTCCTGAAGCTGGCA
XM_005250769.1      GTGTTGGCCATGGTGACCTGTGCAGTTTTCCTCCGGCTGAACTCCGTCCTGAAGCTGGCA
NM_001115.2         GTGTTGGCCATGGTGACCTGTGCAGTTTTCCTCCGGCTGAACTCCGTCCTGAAGCTGGCA
                    ************************************************************

HsCD00082614        GTGCTGCTGATCATGATTGCCATCTATGCCCTGCTCACTGAGACCGTCTACGCAGGCCTC
XM_005250769.1      GTGCTGCTGATCATGATTGCCATCTATGCCCTGCTCACTGAGACCGTCTACGCAGGCCTC
NM_001115.2         GTGCTGCTGATCATGATTGCCATCTATGCCCTGCTCACTGAGACCGTCTACGCAGGCCTC
                    ************************************************************

HsCD00082614        TTTCTGCGTTATGACAACCTCAACCACAGTGGAGAAGATTTCCTGGGGACCAAGGAGGTA
XM_005250769.1      TTTCTGCGTTATGACAACCTCAACCACAGTGGAGAAGATTTCCTGGGGACCAAGGAGGTA
NM_001115.2         TTTCTGCGTTATGACAACCTCAACCACAGTGGAGAAGATTTCCTGGGGACCAAGGAGGTA
                    ************************************************************

HsCD00082614        TCACTGCTACTGATGGCCATGTTCCTCCTGGCTGTGTTCTACCATGGACAGCAGCTGGAG
XM_005250769.1      TCACTGCTACTGATGGCCATGTTCCTCCTGGCTGTGTTCTACCATGGACAGCAGCTGGAG
NM_001115.2         TCACTGCTACTGATGGCCATGTTCCTCCTGGCTGTGTTCTACCATGGACAGCAGCTGGAG
                    ************************************************************

HsCD00082614        TACACAGCCCGCCTGGACTTCCTTTGGCGAGTACAGGCCAAAGAGGAGATCAATGAGATG
XM_005250769.1      TACACAGCCCGCCTGGACTTCCTTTGGCGAGTACAGGCCAAAGAGGAGATCAATGAGATG
NM_001115.2         TACACAGCCCGCCTGGACTTCCTTTGGCGAGTACAGGCCAAAGAGGAGATCAATGAGATG
                    ************************************************************

HsCD00082614        AAGGAGCTGAGGGAACACAATGAGAACATGCTCCGGAATATCTTACCCAGCCATGTGGCC
XM_005250769.1      AAGGAGCTGAGGGAACACAATGAGAACATGCTCCGGAATATCTTACCCAGCCATGTGGCC
NM_001115.2         AAGGAGCTGAGGGAACACAATGAGAACATGCTCCGGAATATCTTACCCAGCCATGTGGCC
                    ************************************************************

HsCD00082614        CGCCATTTCCTAGAGAAGGACCGAGACAATGAGGAGCTGTATTCTCAATCCTATGATGCT
XM_005250769.1      CGCCATTTCCTAGAGAAGGACCGAGACAATGAGGAGCTGTATTCTCAATCCTATGATGCT
NM_001115.2         CGCCATTTCCTAGAGAAGGACCGAGACAATGAGGAGCTGTATTCTCAATCCTATGATGCT
                    ************************************************************

HsCD00082614        GTTGGGGTGATGTTTGCCTCCATCCCAGGATTTGCGGACTTTTACTCTCAGACTGAAATG
XM_005250769.1      GTTGGGGTGATGTTTGCCTCCATCCCAGGATTTGCGGACTTTTACTCTCAGACTGAAATG
NM_001115.2         GTTGGGGTGATGTTTGCCTCCATCCCAGGATTTGCGGACTTTTACTCTCAGACTGAAATG
                    ************************************************************

HsCD00082614        AATAACCAGGGAGTGGAATGCCTGCGCTTGCTCAATGAGATCATTGCTGACTTCGATGAG
XM_005250769.1      AATAACCAGGGAGTGGAATGCCTGCGCTTGCTCAATGAGATCATTGCTGACTTCGATGAG
NM_001115.2         AATAACCAGGGAGTGGAATGCCTGCGCTTGCTCAATGAGATCATTGCTGACTTCGATGAG
                    ************************************************************

HsCD00082614        TTGCTTGGTGAAGACCGATTTCAAGACATTGAAAAGATTAAGACCATTGGCAGCACCTAC
XM_005250769.1      TTGCTTGGTGAAGACCGATTTCAAGACATTGAAAAGATTAAGACCATTGGCAGCACCTAC
NM_001115.2         TTGCTTGGTGAAGACCGATTTCAAGACATTGAAAAGATTAAGACCATTGGCAGCACCTAC
                    ************************************************************

HsCD00082614        ATGGCCGTGTCAGGCCTGTCACCTGAAAAACAGCAATGTGAAGACAAGTGGGGACATTTG
XM_005250769.1      ATGGCCGTGTCAGGCCTGTCACCTGAAAAACAGCAATGTGAAGACAAGTGGGGACATTTG
NM_001115.2         ATGGCCGTGTCAGGCCTGTCACCTGAAAAACAGCAATGTGAAGACAAGTGGGGACATTTG
                    ************************************************************

HsCD00082614        TGTGCTCTGGCTGACTTCTCACTCGCCCTGACAGAAAGCATACAGGAGATCAACAAGCAT
XM_005250769.1      TGTGCTCTGGCTGACTTCTCACTCGCCCTGACAGAAAGCATACAGGAGATCAACAAGCAT
NM_001115.2         TGTGCTCTGGCTGACTTCTCACTCGCCCTGACAGAAAGCATACAGGAGATCAACAAGCAT
                    ************************************************************

HsCD00082614        TCATTCAACAATTTTGAACTCCGGATTGGCATCAGCCACGGCTCAGTGGTAGCTGGCGTT
XM_005250769.1      TCATTCAACAATTTTGAACTCCGGATTGGCATCAGCCACGGCTCAGTGGTAGCTGGCGTT
NM_001115.2         TCATTCAACAATTTTGAACTCCGGATTGGCATCAGCCACGGCTCAGTGGTAGCTGGCGTT
                    ************************************************************

HsCD00082614        ATCGGCGCTAAGAAACCACAGTATGACATTTGGGGCAAAACTGTGAACCTGGCAAGCCGA
XM_005250769.1      ATCGGCGCTAAGAAACCACAGTATGACATTTGGGGCAAAACTGTGAACCTGGCAAGCCGA
NM_001115.2         ATCGGCGCTAAGAAACCACAGTATGACATTTGGGGCAAAACTGTGAACCTGGCAAGCCGA
                    ************************************************************

HsCD00082614        ATGGACAGCACGGGGGTTAGTGGCCGGATCCAAGTCCCAGAGGAGACCTATCTCATCCTG
XM_005250769.1      ATGGACAGCACGGGGGTTAGTGGCCGGATCCAAGTCCCAGAGGAGACCTATCTCATCCTG
NM_001115.2         ATGGACAGCACGGGGGTTAGTGGCCGGATCCAAGTCCCAGAGGAGACCTATCTCATCCTG
                    ************************************************************

HsCD00082614        AAGGACCAGGGCTTTGCCTTTGATTACCGAGGGGAGATCTATGTGAAGGGTATCAGTGAA
XM_005250769.1      AAGGACCAGGGCTTTGCCTTTGATTACCGAGGGGAGATCTATGTGAAGGGTATCAGTGAA
NM_001115.2         AAGGACCAGGGCTTTGCCTTTGATTACCGAGGGGAGATCTATGTGAAGGGTATCAGTGAA
                    ************************************************************

HsCD00082614        CAGGAAGGAAAAATCAAAACGTACTTTCTTCTGGGAAGAGTCCAACCCAACCCATTCATC
XM_005250769.1      CAGGAAGGAAAAATCAAAACGTACTTTCTTCTGGGAAGAGTCCAACCCAACCCATTCATC
NM_001115.2         CAGGAAGGAAAAATCAAAACGTACTTTCTTCTGGGAAGAGTCCAACCCAACCCATTCATC
                    ************************************************************

HsCD00082614        TTGCCCCCAAGAAGACTGCCTGGGCAGTACTCCCTGGCCGCGGTTGTCCTGGGACTTGTC
XM_005250769.1      TTGCCCCCAAGAAGACTGCCTGGGCAGTACTCCCTGGCCGCGGTTGTCCTGGGACTTGTC
NM_001115.2         TTGCCCCCAAGAAGACTGCCTGGGCAGTACTCCCTGGCCGCGGTTGTCCTGGGACTTGTC
                    ************************************************************

HsCD00082614        CAGTCCCTCAATAGGCAAAGGCAGAAGCAGCTACTCAATGAGAACAACAACACAGGAATC
XM_005250769.1      CAGTCCCTCAATAGGCAAAGGCAGAAGCAGCTACTCAATGAGAACAACAACACAGGAATC
NM_001115.2         CAGTCCCTCAATAGGCAAAGGCAGAAGCAGCTACTCAATGAGAACAACAACACAGGAATC
                    ************************************************************

HsCD00082614        ATCAAGGGTCATTACAACCGGCGGACTTTGTTGTCACCCAGCGGCACAGAGCCTGGAGCC
XM_005250769.1      ATCAAGGGTCATTACAACCGGCGGACTTTGTTGTCACCCAGCGGCACAGAGCCTGGAGCC
NM_001115.2         ATCAAGGGTCATTACAACCGGCGGACTTTGTTGTCACCCAGCGGCACAGAGCCTGGAGCC
                    ************************************************************

HsCD00082614        CAGGCTGAAGGCACCGACAAATCTGATTTGCCA---
XM_005250769.1      CAGGCTGAAGGCACCGACAAATCTGATTTGCCATAA
NM_001115.2         CAGGCTGAAGGCACCGACAAATCTGATTTGCCATAA
                    *********************************   

Pathways

NCI : Endothelins
NCI : LPA receptor mediated events
NCI : LPA4-mediated signaling events
Panther : Endothelin signaling pathway
Panther : GABA-B receptor II signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Reactome : Activation of GABAB receptors
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adenylate cyclase activating pathway
Reactome : Adenylate cyclase inhibitory pathway
Reactome : Aquaporin-mediated transport
Reactome : CREB phosphorylation through the activation of Adenylate Cyclase
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : G alpha (i) signalling events
Reactome : G alpha (s) signalling events
Reactome : G alpha (z) signalling events
Reactome : G-protein mediated events
Reactome : GABA B receptor activation
Reactome : GABA receptor activation
Reactome : GPCR downstream signaling
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Immune System
Reactome : Inhibition of adenylate cyclase pathway
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : PKA activation
Reactome : PKA activation in glucagon signalling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Post NMDA receptor activation events
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : G Protein Signaling Pathways
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : CYCc : Adenylyl- / guanylyl cyclase, catalytic domain
UniProt : Q4F7X0
UniProt : P40145
HPRD : 00051

Clone

Cloning Information : 267391
HIP Master Clone ID : 199520
IMAGE ID : 40080646
Original Clone ID : FLH267391.01L

Organism


TAX_ID : 9606
Species Specific ID: 114

Genome

Chromosome : 8
Map Location : 8q24
Ensembl : ENSG00000155897

Reagents

Labome : ADCY8-antibody