DNASU Plasmid Repository • 480.965.5697 | Email

IAPP (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IAPP
Gene Name:  islet amyloid polypeptide
Sequence             
Original Clone ID: FLH267440.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082663

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 267nts         Open reading frame : 1 to 267
Reference Sequence Alignment

ATGGGCATCCTGAAGCTGCAAGTATTTCTCATTGTGCTCTCTGTTGCATTGAACCATCTG
AAAGCTACACCCATTGAAAGTCATCAGGTGGAAAAGCGGAAATGCAACACTGCCACATGT
GCAACGCAGCGCCTGGCAAATTTTTTAGTTCATTCCAGCAACAACTTTGGTGCCATTCTC
TCATCTACCAACGTGGGATCCAATACATATGGCAAGAGGAATGCAGTAGAGGTTTTAAAG
AGAGAGCCACTGAATTACTTGCCCCTT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 301
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
GGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IAPP
Symbol Nomenclature : IAPP
SYNONYM : DAP; IAP
Designation : Islet amyloid polypeptide (diabetes-associated peptide; amylin)|amylin|diabetes-associated peptide|insulinoma amyloid peptide
Full Nomenclature : islet amyloid polypeptide
GENEID : 3375
GI : 109073264
GenBank Accession : BC111849
HGNC : 5329
MIM : 147940
Vega : OTTHUMG00000169128
Target GenBank: BC111849

 

Reference Sequence Alignment

  

HsCD00082663      ATGGGCATCCTGAAGCTGCAAGTATTTCTCATTGTGCTCTCTGTTGCATTGAACCATCTG
NM_000415.2       ATGGGCATCCTGAAGCTGCAAGTATTTCTCATTGTGCTCTCTGTTGCATTGAACCATCTG
                  ************************************************************

HsCD00082663      AAAGCTACACCCATTGAAAGTCATCAGGTGGAAAAGCGGAAATGCAACACTGCCACATGT
NM_000415.2       AAAGCTACACCCATTGAAAGTCATCAGGTGGAAAAGCGGAAATGCAACACTGCCACATGT
                  ************************************************************

HsCD00082663      GCAACGCAGCGCCTGGCAAATTTTTTAGTTCATTCCAGCAACAACTTTGGTGCCATTCTC
NM_000415.2       GCAACGCAGCGCCTGGCAAATTTTTTAGTTCATTCCAGCAACAACTTTGGTGCCATTCTC
                  ************************************************************

HsCD00082663      TCATCTACCAACGTGGGATCCAATACATATGGCAAGAGGAATGCAGTAGAGGTTTTAAAG
NM_000415.2       TCATCTACCAACGTGGGATCCAATACATATGGCAAGAGGAATGCAGTAGAGGTTTTAAAG
                  ************************************************************

HsCD00082663      AGAGAGCCACTGAATTACTTGCCCCTT---
NM_000415.2       AGAGAGCCACTGAATTACTTGCCCCTTTAG
                  ***************************   

Pathways

Reactome : Amyloids
Reactome : Calcitonin-like ligand receptors
Reactome : Class B/2 (Secretin family receptors)
Reactome : Developmental Biology
Reactome : Disease
Reactome : G alpha (s) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Regulation of beta-cell development
Reactome : Regulation of gene expression in beta cells
Reactome : Signal Transduction
Reactome : Signaling by GPCR

Protein

SMART domain : CALCITONIN : calcitonin
UniProt : P10997
HPRD : 01005

Clone

Cloning Information : 267440
HIP Master Clone ID : 199569
IMAGE ID : 40080837
Original Clone ID : FLH267440.01L

Organism


TAX_ID : 9606
Species Specific ID: 3375

Genome

Chromosome : 12
Map Location : 12p12.1
Ensembl : ENSG00000121351

Reagents

Labome : IAPP-antibody