DNASU Plasmid Repository • 480.965.2857 | Email

TM0077 (Thermotoga maritima) in pMH1 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TM0077
Gene Name:  acetyl xylan esterase
Sequence             
Original Clone ID: 7035
Keyword: None
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH1               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: Next amino acid codon after CDS represents STOP, hence clone should be labeled for CDS 'fusion', overall 'closed'
Mutation/
Discrepancy :
No / No
Publications: PMID: 22659119
Title: The structural basis for the narrow substrate specificity of an acetyl esterase from Thermotoga maritima
Authors: PSI
Joint Center for Structural Genomics
TmCD00083900

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 978nts         Open reading frame : 37 to 1014

ATGGGATCTGATAAAATTCATCATCATCATCATCACATGGCCTTCTTCGATTTACCACTC
GAAGAACTGAAGAAATATCGTCCAGAGCGGTACGAAGAGAAAGACTTCGATGAGTTCTGG
GAAGAGACACTCGCAGAGAGCGAAAAGTTCCCCTTAGACCCCGTCTTCGAGAGGATGGAG
TCTCACCTCAAAACAGTCGAAGCGTACGATGTCACCTTCTCCGGATACAGGGGACAGAGG
ATCAAAGGGTGGCTCCTTGTTCCAAAACTGGAAGAAGAAAAACTTCCCTGCGTTGTGCAG
TACATAGGATACAACGGTGGAAGAGGATTCCCTCACGACTGGCTGTTCTGGCCTTCTATG
GGTTACATATGTTTCGTCATGGATACTCGAGGTCAGGGAAGCGGCTGGCTGAAAGGAGAC
ACACCGGATTACCCTGAGGGTCCCGTTGACCCTCAGTATCCAGGATTCATGACAAGAGGA
ATACTGGATCCCAGAACTTACTACTACAGACGAGTCTTCACGGACGCTGTCAGAGCCGTT
GAAGCTGCTGCTTCTTTTCCTCAGGTAGATCAAGAAAGAATCGTGATAGCTGGAGGCAGT
CAGGGTGGCGGAATAGCCCTTGCGGTGAGCGCTCTCTCAAAGAAAGCAAAGGCTCTTCTG
TGCGATGTGCCGTTTCTGTGTCACTTCAGAAGAGCAGTACAGCTTGTGGATACGCATCCA
TACGCGGAGATCACGAACTTTCTAAAGACCCACAGAGACAAGGAAGAAATCGTGTTCAGG
ACTCTTTCCTATTTCGATGGAGTGAACTTCGCAGCCAGAGCGAAGATCCCTGCGCTGTTT
TCTGTGGGTCTCATGGACAACATTTGTCCTCCTTCAACGGTTTTCGCTGCCTACAATTAC
TACGCTGGACCGAAGGAAATCAGAATCTATCCGTACAACAACCACGAGGGAGGAGGCTCT
TTCCAAGCGGTTGAACAGGTGAAATTCTTGAAAAAACTATTTGAGAAAGGCTAAGTTTAA
ACGGTCTCCAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 978
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence:
GTTTAAACGGTCTCCAG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DL41
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: DL41
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH1

pMH1 in advanced viewed

Synonyms: pMH-1
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial (E. coli) expression vector, arabinose inducible expression, adds N-terminal 6xHis tag; amp resistance; restriction enzyme (Pml I/Psi I) or PIPE cloning.
Comments: None
Size (bp): 4048
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, inducible expression, with tag/fusion/marker
Author Name: JCSG
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 1887 2569
inducible trxn activator protein gene araC araC cds 3144 4019
promoter araC araC promoter 256 285
promoter pBAD pBAD promoter 250 277
selectable marker AmpR ampicillin resistance gene 1130 1789
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 794 820

 


Cloning Information: 271525
HIP Master Clone ID: 202235
Original Clone ID: 7035
PDB - Structural Annotation: 3M81
PDB - Structural Annotation: 3M82
PDB - Structural Annotation: 3M83
PDB - Structural Annotation: 1VLQ
Structural Annotation Wiki: TOPSAN
Structural Biology Knowledgebase: SBKB (3M83)
Structural Biology Knowledgebase: SBKB (3M82)
Structural Biology Knowledgebase: SBKB (3M81)
Structural Biology Knowledgebase: SBKB (1VLQ)
TargetTrack - Experimental data: 281958
Species Specific ID: 896903
Target GenBank: NP_227893
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color