DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  None
Gene Name:  None
Sequence             
Original Clone ID: 40462
Keyword: None
Species: Lactobacillus acidophilus NCFM
Type: cDNA
Vector Name: pSpeedET               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
LaCD00085967

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 453nts         Open reading frame : 51 to 503

CTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGCATGGCTAAAA
AAACATTAATTTTATATTATTCTTGGTCTGGTGAAACCAAGAAAATGGCGGAAAAGATCA
ATAGTGAAATTAAAGATAGCGAGCTCAAAGAAGTAAAAGTATCTGAAGGAACTTTTGATG
CTGATATGTATAAGACTTCAGATATCGCATTAGATCAAATTCAAGGAAATAAGGATTTTC
CAGAAATCCAATTAGATAATATAGATTATAATAATTATGATTTAATCTTAATTGGTAGTC
CAGTTTGGTCAGGCTATCCTGCAACTCCAATCAAAACTTTACTTGATCAAATGAAGAATT
ATAGAGGCGAAGTTGCATCATTCTTTACTTCAGCTGGAACAAATCATAAAGCATATGTTA
GTCACTTTAATGAATGGGCAGATGGTTTGAATGTTATTGGTGTGGCTAGAGATGATAGTG
AAGTTGATAAATGGAGTAAATAACGCGACTTAATTAATTTGGCGGATGAGAGAAGATTTT
CAGCCTGATACAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 453
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGC

3' Linker Sequence:
CGCGACTTAATTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 388454
Recommended expression in: HK100
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSpeedET

pSpeedET in advanced viewed

Synonyms: pSpeed-ET
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHHENLYFQG tag; kanamycin resistance; PIPE cloning.
Comments: If this vector contains an insert, the ccdB death cassette will not be present.
Size (bp): 5464
Parent Vector: None
Empty Vector: EvNO00285791
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: PMID: 18004753
Title: Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type origin of replication 3306 3988
inducible trxn activator protein gene araC araC coding sequence 4563 5438
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 1596 1805
promoter araC araC promoter 256 285
promoter T7 T7 promoter 290 310
protease cleavage site TEV TEV protease cleavage site 382 402
selectable marker CmR chloramphenicol resistance gene (CmR) (lost in with-insert form) 502 1158
selectable marker KanR kanamycin resistance gene 2396 3208
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn termination sequence rrnB rrnB T2 transcription terminator 2258 2284

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Reagents

Gene

Target GenBank: YP_193882

 

Protein

PDB - Structural Annotation : 3EDO
Structural Annotation Wiki : TOPSAN
UniProt : Q5FKC3
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 286399
HIP Master Clone ID : 215885
Original Clone ID : 40462

Experimental

Structural Biology Knowledgebase : SBKB (3EDO)
TargetTrack - Experimental data : 388454

Reagents

Labome : LBA1001-cDNA