DNASU Plasmid Repository • 480.965.5697 | Email

MAD1L1 (Homo sapiens) in pLenti6.3/V5-DEST

TOP

Explanation of Terms


Gene: Gene Symbol:  MAD1L1
Gene Name:  mitotic arrest deficient 1 like 1
Sequence             
Original Clone ID: None
Keyword: STOP codon removed based on OC annotation
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.3/V5-DEST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00936174

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2154nts        
Open reading frame : 1 to 2154

ATGGAAGACCTGGGGGAAAACACCATGGTTTTATCCACCCTGAGATCTTTGAACAACTTC
ATCTCTCAGCGTGTGGAGGGAGGCTCTGGACTGGATATTTCTACCTCGGCCCCAGGTTCT
CTGCAGATGCAGTACCAGCAGAGCATGCAGCTGGAGGAAAGAGCAGAGCAGATCCGTTCG
AAGTCCCACCTCATCCAGGTGGAGCGGGAGAAAATGCAGATGGAGCTGAGTCACAAGAGG
GCTCGAGTGGAGCTGGAGAGAGCAGCCAGCACCAGTGCCAGGAACTACGAGCGTGAGGTC
GACCGCAACCAGGAGCTCCTGACGCGCATCCGGCAGCTTCAGGAGCGGGAGGCCGGGGCG
GAGGAGAAGATGCAGGAGCAGCTGGAGCGCAACAGGCAGTGTCAGCAGAACTTGGATGCT
GCCAGCAAGAGGCTGCGTGAGAAAGAGGACAGTCTGGCCCAGGCTGGCGAGACCATCAAC
GCACTGAAGGGGAGGATCTCGGAACTGCAGTGGAGCGTGATGGACCAGGAGATGCGGGTG
AAGCGCCTGGAGTCGGAGAAGCAGGAGCTGCAGGAGCAGCTGGACCTGCAACACAAAAAA
TGCCAGGAAGCCAATCAGAAAATCCAGGAACTCCAGGCCAGCCAAGAAGCAAGAGCAGAC
CACGAGCAGCAGATTAAGGATCTGGAGCAGAAGCTGTCCCTGCAAGAGCAGGATGCAGCG
ATTGTGAAGAACATGAAGTCTGAGCTGGTACGGCTCCCTAGGCTGGAACGGGAGCTGAAG
CAGCTGCGGGAGGAGAGCGCGCACCTGCGGGAGATGAGAGAGACCAACGGGCTGCTCCAG
GAAGAGCTGGAAGGGCTGCAGAGGAAGCTGGGGCGCCAGGAGAAGATGCAGGAGACGCTG
GTTGGCTTGGAGCTGGAGAACGAGAGGCTGCTGGCCAAGCTGCAAAGCTGGGAGAGACTG
GACCAGACCATGGGCCTGAGCATCAGGACTCCAGAAGACCTTTCCAGATTCGTGGTTGAG
CTGCAGCAGAGGGAGCTTGCCTTGAAGGACAAGAACAGCGCCGTCACCAGCAGCGCCCGG
GGGCTGGAGAAGGCCAGGCAGCAGCTGCAGGAGGAGCTCCGGCAGGTCAGCGGCCAGCTG
TTGGAGGAGAGGAAGAAGCGCGAGACCCACGAGGCGCTGGCCCGGAGGCTCCAGAAACGG
GTCCTGCTGCTCACCAAGGAGCGGGACGGTATGCGGGCCATCCTGGGGTCCTACGACAGC
GAGCTGACCCCGGCCGAGTACTCACCCCAGCTGACGCGGCGCATGCGGGAGGCTGAGGAT
ATGGTGCAGAAGGTGCACAGCCACAGCGCCGAGATGGAGGCTCAGCTGTCGCAGGCCCTG
GAGGAGCTGGGAGGCCAGAAACAAAGAGCAGACATGCTGGAGATGGAGCTGAAGATGCTG
AAGTCTCAGTCCAGCTCTGCCGAACAGAGCTTCCTGTTCTCCAGGGAGGAGGCGGACACG
CTCAGGTTGAAGGTCGAGGAGCTGGAAGGCGAGCGGAGTCGGCTGGAGGAGGAAAAGAGG
ATGCTGGAGGCACAGCTGGAGCGGCGAGCTCTGCAGGGTGACTATGACCAGAGCAGGACC
AAAGTGCTGCACATGAGCCTGAACCCCACCAGTGTGGCCAGGCAGCGCCTGCGCGAGGAC
CACAGCCAGCTGCAGGCGGAGTGCGAGCGACTGCGCGGGCTCCTGCGCGCCATGGAGAGA
GGAGGCACCGTCCCAGCCGACCTTGAGGCTGCCGCCGCGAGTCTGCCATCGTCCAAGGAG
GTGGCAGAGCTGAAGAAGCAGGTGGAGAGTGCCGAGCTGAAGAACCAGCGGCTCAAGGAG
GTTTTCCAGACCAAGATCCAGGAGTTCCGCAAGGCCTGCTACACGCTCACCGGCTACCAG
ATCGACATCACCACGGAGAACCAGTACCGGCTGACCTCGCTGTACGCCGAGCACCCAGGC
GACTGCCTCATCTTCAAGGCCACCAGCCCCTCGGGTTCCAAGATGCAGCTACTGGAGACA
GAGTTCTCACACACCGTGGGCGAGCTCATCGAGGTGCACCTGCGGCGCCAGGACAGCATC
CCTGCCTTCCTCAGCTCGCTCACCCTCGAGCTCTTCAGCCGCCAGACCGTGGCG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGAATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.3/V5-DEST

pLenti6.3V5-DEST in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: with tag/fusion/marker assay, Gateway® acceptor (destination), recombinational cloning clone, lentiviral infection, mammalian expression expression with CMV and RSV/5' LTR hybrid promoter and 5' splice donor and HIV-1 psi and HIV-1 RRE and 3' splice acceptor; ampicillin resistance in bacterial, chloramphenicol resistance in bacterial, blasticidin resistance in mammalian;
Comments: pLent6.3/V5-DEST from Invitrogen: https://www.thermofisher.com/order/catalog/product/V53306 Catalog: V53306 For research use only. Not intended for any therapeutic or diagnostic use. The upgrade from pLenti6 to pLenti6.3 is in the addition of a WPRE cassette. Lentiviral Gateway destination vector for expression of a C-terminally V5-tagged protein.
Size (bp): 9387
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
Miscellaneous Feature V5 C-terminal V5 tag 4325 4366
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
promoter CMV CMV Promoter 1935 2519
promoter RSV/5' LTR hybrid promoter RSV promoter 1-229; HIV-1 5' LTR 230-410 1 410
recombination site attR1 2568 2692
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
splice acceptor site 3' splice acceptor 3' splice acceptor 1656 1656
splice donor site 5' splice donor 5' splice donor site 520 520
trln enhancer WPRE 4385 4982

 

  • Gene
  • Clone
  • Organism

Gene

Target GenBank: BC009964.2

 

Clone

Cloning Information : 999484

Organism


Species Specific ID: 8379