DNASU Plasmid Repository • 480.965.5697 | Email

EIF4A1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF4A1
Gene Name:  eukaryotic translation initiation factor 4A1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007749.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000943

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1221nts         Open reading frame : 1 to 1221
Reference Sequence Alignment

ATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGATGGGATGGAGCCCGAA
GGCGTCATCGAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTCTCG
GAGTCCCTTCTCCGTGGCATCTACGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAG
CGAGCCATTCTACCTTGTATCAAGGGTTATGATGTGATTGCTCAAGCCCAATCTGGGACT
GGGAAAACGGCCACATTTGCCATATCGATTCTGCAGCAGATTGAATTAGATCTAAAAGCC
ACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGCTCAGCAGATACAGAAGGTGGTC
ATGGCACTAGGAGACTACATGGGCGCCTCCTGTCACGCCTGTATCGGGGGCACCAACGTG
CGTGCTGAGGTGCAGAAACTGCAGATGGAAGCTCCCCACATCATCGTGGGTACCCCTGGC
CGTGTGTTTGATATGCTTAACCGGAGATACCTGTCCCCCAAATACATCAAGATGTTTGTA
CTGGATGAAGCTGACGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTC
CAAAAGCTCAACAGCAACACCCAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGATGTG
CTTGAGGTGACCAAGAAGTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAAGAG
TTGACCCTGGAGGGTATCCGCCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAGCTG
GACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTTCATCAAC
ACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGTATCC
GCCATGCATGGAGATATGGACCAAAAGGAACGAGACGTGATTATGAGGGAGTTTCGTTCT
GGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGCCAGAGGCATTGATGTGCAGCAG
GTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACTATATCCACAGAATC
GGTCGAGGTGGACGGTTTGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAAGAC
AAGAGGACTCTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGAAATGCCCCTC
AATGTTGCTGACCTCATCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1237
Start on reference sequence 17
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF4A1
Symbol Nomenclature : EIF4A1
SYNONYM : DDX2A; EIF-4A; EIF4A; eIF-4A-I; eIF4A-I
Designation : ATP-dependent RNA helicase eIF4A-1|eukaryotic initiation factor 4A-I|eukaryotic initiation factor 4AI|eukaryotic translation initiation factor 4A
Full Nomenclature : eukaryotic translation initiation factor 4A1
GENEID : 1973
GI : 61357586
GenBank Accession : AY888467
HGNC : 3282
MIM : 602641
Vega : OTTHUMG00000108149
Target GenBank: NM_001416

 

Reference Sequence Alignment

  

HsCD00000943      ---ATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGATGGGATGGAGCCC
NM_001967.3       ATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCC
NM_001416.3       ---ATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGATGGGATGGAGCCC
                     :    **  : * .*****. ...: ...* * .. *****.** **.***** ***

HsCD00000943      GAAGGCGTCATCGAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTC
NM_001967.3       GATGGTGTCATCGAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAATTTA
NM_001416.3       GAAGGCGTCATCGAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTC
                  **:** *********** ******************** *.********* *****  *.

HsCD00000943      TCGGAGTCCCTTCTCCGTGGCATCTACGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAG
NM_001967.3       AAGGAGTCTCTCCTTCGTGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATTCAG
NM_001416.3       TCGGAGTCCCTTCTCCGTGGCATCTACGCGTATGGTTTTGAGAAGCCCTCTGCCATCCAG
                  :.****** ** ** *********** ** ** ************** ** ** ** ***

HsCD00000943      CAGCGAGCCATTCTACCTTGTATCAAGGGTTATGATGTGATTGCTCAAGCCCAATCTGGG
NM_001967.3       CAGAGAGCTATTATTCCCTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGT
NM_001416.3       CAGCGAGCCATTCTACCTTGTATCAAGGGTTATGATGTGATTGCTCAAGCCCAATCTGGG
                  ***.**** ***.*:** ***** **.** ******************** **.**:** 

HsCD00000943      ACTGGGAAAACGGCCACATTTGCCATATCGATTCTGCAGCAGATTGAATTAGATCTAAAA
NM_001967.3       ACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAG
NM_001416.3       ACTGGGAAAACGGCCACATTTGCCATATCGATTCTGCAGCAGATTGAATTAGATCTAAAA
                  ***** **.**.*********** **:** ** *****.***:* **.:*:**  *.**.

HsCD00000943      GCCACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGCTCAGCAGATACAGAAGGTG
NM_001967.3       GAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTA
NM_001416.3       GCCACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGCTCAGCAGATACAGAAGGTG
                  *. *****.**. *.**. *.**.***** .***** *******.*****.**.*****.

HsCD00000943      GTCATGGCACTAGGAGACTACATGGGCGCCTCCTGTCACGCCTGTATCGGGGGCACCAAC
NM_001967.3       ATTCTGGCACTTGGAGACTATATGGGAGCCACTTGTCATGCCTGCATTGGTGGAACAAAT
NM_001416.3       GTCATGGCACTAGGAGACTACATGGGCGCCTCCTGTCACGCCTGTATCGGGGGCACCAAC
                  .* .*******:******** *****.***:* ***** ***** ** ** **.**.** 

HsCD00000943      GTGCGTGCTGAGGTGCAGAAACTGCAGATGGAAGCTCCCCACATCATCGTGGGTACCCCT
NM_001967.3       GTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCC
NM_001416.3       GTGCGTGCTGAGGTGCAGAAACTGCAGATGGAAGCTCCCCACATCATCGTGGGTACCCCT
                  ** **:..***..****.*********.  *****:**.** ** .* ** *****.** 

HsCD00000943      GGCCGTGTGTTTGATATGCTTAACCGGAGATACCTGTCCCCCAAATACATCAAGATGTTT
NM_001967.3       GGGAGAGTGTTTGATATGTTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTT
NM_001416.3       GGCCGTGTGTTTGATATGCTTAACCGGAGATACCTGTCCCCCAAATACATCAAGATGTTT
                  ** .*:************ *:***.*.******** ** **.****. *****.******

HsCD00000943      GTACTGGATGAAGCTGACGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATA
NM_001967.3       GTTTTGGATGAAGCAGATGAAATGTTGAGCCGTGGTTTTAAGGATCAAATCTATGAGATT
NM_001416.3       GTACTGGATGAAGCTGACGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATA
                  **: **********:** ********.********:** ***** **.******** **:

HsCD00000943      TTCCAAAAGCTCAACAGCAACACCCAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGAT
NM_001967.3       TTCCAAAAACTAAACACAAGTATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGAT
NM_001416.3       TTCCAAAAGCTCAACAGCAACACCCAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGAT
                  ********.**.**** .*. *  *****:** ***** **:***********::*****

HsCD00000943      GTGCTTGAGGTGACCAAGAAGTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAA
NM_001967.3       GTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAAAAGGAA
NM_001416.3       GTGCTTGAGGTGACCAAGAAGTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAA
                  *** * **.********.**.********.** **.*****.***** ** **.******

HsCD00000943      GAGTTGACCCTGGAGGGTATCCGCCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAG
NM_001967.3       GAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAGAGAGAGGAATGGAAG
NM_001416.3       GAGTTGACCCTGGAGGGTATCCGCCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAG
                  **.******** **.**:***...***** ** ** ** ** **..*******.******

HsCD00000943      CTGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTTCATC
NM_001967.3       TTGGATACACTTTGTGACTTGTACGAGACACTGACCATTACACAGGCTGTTATTTTTCTC
NM_001416.3       CTGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTTCATC
                   **** *****:*********** **.**.******** **.*****:** ** ** .**

HsCD00000943      AACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGTA
NM_001967.3       AATACGAGGCGCAAGGTGGACTGGCTGACTGAGAAGATGCATGCCAGAGACTTCACAGTT
NM_001416.3       AACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGTA
                  ** ** .**.* ************** ** ************** .**** *****:**:

HsCD00000943      TCCGCCATGCATGGAGATATGGACCAAAAGGAACGAGACGTGATTATGAGGGAGTTTCGT
NM_001967.3       TCTGCTCTGCATGGTGACATGGACCAGAAGGAGAGAGATGTTATCATGAGGGAATTCCGG
NM_001416.3       TCCGCCATGCATGGAGATATGGACCAAAAGGAACGAGACGTGATTATGAGGGAGTTTCGT
                  ** ** .*******:** ********.*****..**** ** ** ********.** ** 

HsCD00000943      TCTGGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGCCAGAGGCATTGATGTGCAG
NM_001967.3       TCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGCTCGCGGGATTGATGTGCAA
NM_001416.3       TCTGGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGCCAGAGGCATTGATGTGCAG
                  **:** **:** .*:*** **** ** ****** ** **** .*.** ***********.

HsCD00000943      CAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACTATATCCACAGA
NM_001967.3       CAAGTGTCTTTGGTTATAAATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGA
NM_001416.3       CAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACTATATCCACAGA
                  **.** *****.** **.** ***** **:** ***** .* *********** ******

HsCD00000943      ATCGGTCGAGGTGGACGGTTTGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAA
NM_001967.3       ATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAA
NM_001416.3       ATCGGTCGAGGTGGACGGTTTGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAA
                  ** ** .**** **:**.***** .* **************:***:* ** **:******

HsCD00000943      GACAAGAGGACTCTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGAAATGCCC
NM_001967.3       GACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCC
NM_001416.3       GACAAGAGGACTCTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGAAATGCCC
                  ********** ******:*********** ******** ** :*..* *****.******

HsCD00000943      CTCAATGTTGCTGACCTCATCTAG
NM_001967.3       ATGAATGTGGCTGACCTTATTTAA
NM_001416.3       CTCAATGTTGCTGACCTCATCTGA
                  .* ***** ******** ** *..

Pathways

NCI : Validated targets of C-MYC transcriptional activation
NCI : mTOR signaling pathway
Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cap-dependent Translation Initiation
Reactome : Cytokine Signaling in Immune system
Reactome : Deadenylation of mRNA
Reactome : Deadenylation-dependent mRNA decay
Reactome : Eukaryotic Translation Initiation
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of proteins
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
WikiPathway : Translation Factors

Clone

Cloning Information : 7749
HIP Master Clone ID : 7307
Original Clone ID : FLH007749.01X

Organism


TAX_ID : 9606
Species Specific ID: 1973

Genome

Chromosome : 17
Map Location : 17p13
Ensembl : ENSG00000161960

Reagents

Labome : EIF4A1-antibody