DNASU Plasmid Repository • 480.965.5697 | Email

MAD2L1 (Homo sapiens) in pLenti6.3/V5-DEST

TOP

Explanation of Terms


Gene: Gene Symbol:  MAD2L1
Gene Name:  MAD2 mitotic arrest deficient-like 1 (yeast)
Sequence             
Original Clone ID: None
Keyword: STOP codon removed based on OC annotation
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.3/V5-DEST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00943867

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 615nts        
Open reading frame : 1 to 615

ATGGCGCTGCAGCTCTCCCGGGAGCAGGGAATCACCCTGCGCGGGAGCGCCGAAATCGTG
GCCGAGTTCTTCTCATTCGGCATCAACAGCATTTTATATCAGCGTGGCATATATCCATCT
GAAACCTTTACTCGAGTGCAGAAATACGGACTCACCTTGCTTGTAACTACTGATCTTGAG
CTCATAAAATACCTAAATAATGTGGTGGAACAACTGAAAGATTGGTTATACAAGTGTTCA
GTTCAGAAACTGGTTGTAGTTATCTCAAATATTGAAAGTGGTGAGGTCCTGGAAAGATGG
CAGTTTGATATTGAGTGTGACAAGACTGCAAAAGATGACAGTGCACCCAGAGAAAAGTCT
CAGAAAGCTATCCAGGATGAAATCCGTTCAGTGATCAGACAGATCACAGCTACGGTGACA
TTTCTGCCACTGTTGGAAGTTTCTTGTTCATTTGATCTGCTGATTTATACAGACAAAGAT
TTGGTTGTACCTGAAAAATGGGAAGAGTCGGGACCACAGTTTATTACCAATTCTGAGGAA
GTCCGCCTTCGTTCATTTACTACTACAATCCACAAAGTAAATAGCATGGTGGCCTACAAA
ATTCCTGTCAATGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGAATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.3/V5-DEST

pLenti6.3V5-DEST in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: with tag/fusion/marker assay, Gateway® acceptor (destination), recombinational cloning clone, lentiviral infection, mammalian expression expression with CMV and RSV/5' LTR hybrid promoter and 5' splice donor and HIV-1 psi and HIV-1 RRE and 3' splice acceptor; ampicillin resistance in bacterial, chloramphenicol resistance in bacterial, blasticidin resistance in mammalian;
Comments: pLent6.3/V5-DEST from Invitrogen: https://www.thermofisher.com/order/catalog/product/V53306 Catalog: V53306 For research use only. Not intended for any therapeutic or diagnostic use. The upgrade from pLenti6 to pLenti6.3 is in the addition of a WPRE cassette. Lentiviral Gateway destination vector for expression of a C-terminally V5-tagged protein.
Size (bp): 9387
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
Miscellaneous Feature V5 C-terminal V5 tag 4325 4366
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
promoter CMV CMV Promoter 1935 2519
promoter RSV/5' LTR hybrid promoter RSV promoter 1-229; HIV-1 5' LTR 230-410 1 410
recombination site attR1 2568 2692
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
splice acceptor site 3' splice acceptor 3' splice acceptor 1656 1656
splice donor site 5' splice donor 5' splice donor site 520 520
trln enhancer WPRE 4385 4982

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : MAD2L1
Symbol Nomenclature : MAD2L1
SYNONYM : HSMAD2; MAD2
Designation : MAD2 (mitotic arrest deficient, yeast, homolog)-like 1|MAD2-like protein 1|mitotic arrest deficient 2-like protein 1|mitotic arrest deficient, yeast, homolog-like 1|mitotic spindle assembly checkpoint protein MAD2A
Full Nomenclature : MAD2 mitotic arrest deficient-like 1 (yeast)
GENEID : 4085
GenBank Accession : BC005945
GenBank Accession : BC005945.1
HGNC : 6763
MIM : 601467
Target GenBank: BC005945.1

 

Pathways

Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Amplification of signal from unattached kinetochores via a MAD2 inhibitory signal
Reactome : Amplification of signal from the kinetochores
Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Inactivation of APC/C via direct inhibition of the APC/C complex
Reactome : Inhibition of the proteolytic activity of APC/C required for the onset of anaphase by mitotic spindle checkpoint components
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Mitotic Spindle Checkpoint
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle

Protein

HPRD : 03274

Clone

Cloning Information : 1063669

Organism


TAX_ID : 9606
Species Specific ID: 4085

Genome

Chromosome : 4
Map Location : 4q27