DNASU Plasmid Repository • 480.965.5697 | Email

MX1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MX1
Gene Name:  myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054952.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000098

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1989nts         Open reading frame : 1 to 1989
Reference Sequence Alignment

ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
GCGTTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
CCCGGTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2334
Start on reference sequence 346
Mutations:
None
Discrepancy:
a1135g,I379V; a1623g
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MX1
Symbol Nomenclature : MX1
SYNONYM : IFI-78K; IFI78; MX; MxA
Designation : interferon-induced GTP-binding protein Mx1|interferon-induced protein p78|interferon-regulated resistance GTP-binding protein MxA|myxoma resistance protein 1
Full Nomenclature : myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
GENEID : 4599
GI : 60825047
GenBank Accession : AY893667
HGNC : 7532
MIM : 147150
Vega : OTTHUMG00000086755
Target GenBank: NM_002462

 

Reference Sequence Alignment

  

HsCD00000098        ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
NM_001144925.2      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260981.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260982.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
NM_001178046.2      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260980.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260979.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
NM_002462.4         ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
                    ************************************************************

HsCD00000098        TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
NM_001144925.2      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260981.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260982.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
NM_001178046.2      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260980.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260979.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
NM_002462.4         TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
                    ************************************************************

HsCD00000098        CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
NM_001144925.2      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260981.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260982.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
NM_001178046.2      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260980.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260979.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
NM_002462.4         CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
                    ************************************************************

HsCD00000098        GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
NM_001144925.2      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260981.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260982.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
NM_001178046.2      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260980.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260979.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
NM_002462.4         GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
                    ************************************************************

HsCD00000098        TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
NM_001144925.2      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260981.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260982.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
NM_001178046.2      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260980.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260979.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
NM_002462.4         TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
                    ************************************************************

HsCD00000098        ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
NM_001144925.2      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260981.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260982.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
NM_001178046.2      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260980.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260979.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
NM_002462.4         ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
                    ************************************************************

HsCD00000098        AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
NM_001144925.2      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260981.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260982.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
NM_001178046.2      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260980.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260979.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
NM_002462.4         AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
                    ************************************************************

HsCD00000098        AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
NM_001144925.2      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260981.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260982.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
NM_001178046.2      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260980.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260979.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
NM_002462.4         AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
                    ************************************************************

HsCD00000098        CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
NM_001144925.2      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260981.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260982.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
NM_001178046.2      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260980.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260979.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
NM_002462.4         CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
                    ************************************************************

HsCD00000098        GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
NM_001144925.2      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260981.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260982.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
NM_001178046.2      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260980.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260979.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
NM_002462.4         GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
                    ************************************************************

HsCD00000098        CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
NM_001144925.2      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260981.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260982.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
NM_001178046.2      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260980.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260979.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
NM_002462.4         CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
                    ************************************************************

HsCD00000098        GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
NM_001144925.2      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260981.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260982.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
NM_001178046.2      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260980.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260979.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
NM_002462.4         GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
                    ************************************************************

HsCD00000098        AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
NM_001144925.2      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260981.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260982.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
NM_001178046.2      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260980.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260979.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
NM_002462.4         AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
                    ************************************************************

HsCD00000098        GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
NM_001144925.2      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260981.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260982.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
NM_001178046.2      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260980.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260979.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
NM_002462.4         GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
                    ************************************************************

HsCD00000098        CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
NM_001144925.2      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260981.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260982.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
NM_001178046.2      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260980.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260979.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
NM_002462.4         CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
                    ************************************************************

HsCD00000098        ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
NM_001144925.2      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260981.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260982.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
NM_001178046.2      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260980.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260979.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
NM_002462.4         ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
                    ************************************************************

HsCD00000098        CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
NM_001144925.2      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260981.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260982.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
NM_001178046.2      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260980.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260979.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
NM_002462.4         CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
                    ************************************************************

HsCD00000098        CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
NM_001144925.2      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260981.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260982.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
NM_001178046.2      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260980.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260979.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
NM_002462.4         CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
                    ************************************************************

HsCD00000098        GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
NM_001144925.2      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260981.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260982.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
NM_001178046.2      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260980.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260979.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
NM_002462.4         GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
                    ************************************************************

HsCD00000098        GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
NM_001144925.2      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260981.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260982.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
NM_001178046.2      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260980.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260979.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
NM_002462.4         GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
                    ************************************************************

HsCD00000098        ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
NM_001144925.2      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260981.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260982.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
NM_001178046.2      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260980.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260979.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
NM_002462.4         ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
                    ************************************************************

HsCD00000098        AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
NM_001144925.2      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260981.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260982.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
NM_001178046.2      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260980.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260979.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
NM_002462.4         AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
                    ************************************************************

HsCD00000098        CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
NM_001144925.2      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260981.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260982.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
NM_001178046.2      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260980.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260979.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
NM_002462.4         CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
                    ************************************************************

HsCD00000098        CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
NM_001144925.2      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260981.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260982.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
NM_001178046.2      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260980.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260979.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
NM_002462.4         CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
                    ************************************************************

HsCD00000098        CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
NM_001144925.2      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260981.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260982.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
NM_001178046.2      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260980.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260979.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
NM_002462.4         CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
                    ************************************************************

HsCD00000098        ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
NM_001144925.2      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260981.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260982.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
NM_001178046.2      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260980.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260979.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
NM_002462.4         ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
                    ************************************************************

HsCD00000098        ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
NM_001144925.2      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260981.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260982.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
NM_001178046.2      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260980.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260979.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
NM_002462.4         ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
                    ************************************************************

HsCD00000098        GCGTTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
NM_001144925.2      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260981.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260982.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
NM_001178046.2      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260980.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260979.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
NM_002462.4         GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
                    **.*********************************************************

HsCD00000098        TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
NM_001144925.2      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260981.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260982.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
NM_001178046.2      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260980.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260979.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
NM_002462.4         TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
                    ************************************************************

HsCD00000098        CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
NM_001144925.2      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260981.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260982.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
NM_001178046.2      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260980.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260979.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
NM_002462.4         CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
                    ************************************************************

HsCD00000098        CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
NM_001144925.2      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260981.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260982.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
NM_001178046.2      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260980.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260979.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
NM_002462.4         CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
                    ************************************************************

HsCD00000098        CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
NM_001144925.2      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260981.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260982.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
NM_001178046.2      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260980.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260979.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
NM_002462.4         CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
                    ************************************************************

HsCD00000098        AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
NM_001144925.2      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260981.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260982.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
NM_001178046.2      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260980.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260979.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
NM_002462.4         AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
                    ************************************************************

HsCD00000098        CCCGGTTTG
NM_001144925.2      CCCGGTTAA
XM_005260981.1      CCCGGTTAA
XM_005260982.1      CCCGGTTAA
NM_001178046.2      CCCGGTTAA
XM_005260980.1      CCCGGTTAA
XM_005260979.1      CCCGGTTAA
NM_002462.4         CCCGGTTAA
                    *******:.

Pathways

Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling

Protein

SMART domain : DYNc : Dynamin, GTPase
SMART domain : GED : Dynamin GTPase effector domain
UniProt : B3KU10
UniProt : B2RDA5
UniProt : P20591
HPRD : 00919

Clone

Cloning Information : 54952
HIP Master Clone ID : 13230
Original Clone ID : FLH054952.01L

Organism


TAX_ID : 9606
Species Specific ID: 4599

Genome

Chromosome : 21
Map Location : 21q22.3
Ensembl : ENSG00000157601

Reagents

Labome : MxA-antibody