DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pSGP36

TOP

Vector Name: pSGP36
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pSGP-36

pSGP36

Sequencing Primer: Forward:  pSGP36 forward
Reverse:  pSGP36 reverse
Description: Yeast expression vector with Gal1 promoter, adds C-terminal 3C-his10 tag; amp resistance (URA for yeast); ligation independent cloning (LIC).
Comments: None
Size (bp): 6185
Empty Vector: EvNO00304418
Parent Vector: None
Properties: inducible expression, ligation independent cloning (LIC), with tag/fusion/marker, yeast expression, yeast shuttle
Author Name: Center for High Throughput Structural Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1 bacterial origin 2499 3181
primer forward CAACATTTTCAGTTTGTATTACTTC 3983 4007
primer reverse CAAGGCGATTAAGTTGGGTAACGC 4279 4302
promoter Ura3 promoter Ura3 promoter 5870 5899
promoter T7 T7 promoter 4209 4229
protease cleavage site 3C 3C protease cleavage site 4122 4145
reporter gene LacZ LacZ alpha gene 4326 4394
selectable marker AmpR ampicillin resistance gene 1742 2401
selectable marker Ura3 URA3 nutritional marker 4981 5784
tag His 10xHis tag 4164 4193
trxn regulatory element lac operator lac operator 3521 3543