DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pSGX-TOPO

TOP

Vector Name: pSGX-TOPO
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pSGX-TOPO_KF

pSGX-TOPO

Sequencing Primer: Forward:  pFB forward
Reverse:  pFB reverse
Description: Baculovirus vector, adds N-terminal 6xHis tag and TEV protease site; ampicillin resistance in bacteria (gentamicin resistance in insect cells); TOPO cloning.
Comments: pFastBAC topogated N-His with TEV.
Size (bp): 4793
Empty Vector: None
Parent Vector: None
Properties: TOPO Cloning, baculovirus/insect cell expression, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation ATG 4050 4052
TOPO recognition site TOPO TOPO cloning site 4123 4132
bacterial origin ori pUC-type origin of replication 1544 2226
poly-A signal polyA SV40 poly-A signal sequence 4222 4413
primer pFB reverse reverse sequencing primer: ACAAATGTGGTATGGCTGATT 4183 4203
primer pFB foward forward sequencing primer: TATTCCGGATTATTCATACC 3995 4014
promoter PH polyhedrin promoter 3904 4032
promoter Pc Pc promoter 0 0
selectable marker AmpR ampicillin resistance gene 787 1446
selectable marker GenR gentamycin resistance gene 3000 3533
ssDNA origin f1 ori f1 origin 19 325
tag His 6xHis tag 4062 4079
transposon fragment Tn7R Tn7R transposon sequence 2709 2933
transposon fragment Tn7L Tn7L transposon sequence 0 0