DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nHalo_empty

TOP

Vector Name: pJFT7_nHalo_empty
       DyNA Vector Map

      Powered by LabGenius

Synonyms: ''

pJFT7_nHalo_empty

Sequencing Primer: Forward:  NAP150
Reverse:  T7 terminator
Description: In vitro expression vector with T7 promoter and N-terminal TEV-cleavable Halo tag; does not contain a death cassette; ampicillin resistance; restriction enzyme cloning
Comments: Modified from pANT7_cGST, expresses Halo without an insert
Size (bp): 6166
Empty Vector: EvNO00424543
Parent Vector: None
Properties: cell-free expression, multiple cloning site, with tag/fusion/marker
Author Name: Joshua LaBaer
Justin Saul
Fernanda Festa
Center for Personalized Diagnostics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 1766 2448
bacterial origin M13 Ori M13 origin 3842 4297
enhancer CITE cap-independent translational enhancer (CITE) 17 515
primer HaloseqF HaloseqF forward sequencing primer aagcctgcctaactgcaa 1289 1306
primer M13 forward M13 forward sequencing primer 4441 4458
primer NAP150 NAP150 forward sequencing primer cccattgtatgggatctgatc 388 408
promoter T7 T7 promoter 4457 4481
protease cleavage site TEV TEV protease cleavage site (EDLYFQS) 1422 1442
selectable marker LacZ LacZ alpha gene 4302 4370
selectable marker AmpR Ampicillin resistance gene 2546 3205
tag HALO N-terminal Halo Tag 519 1409
trxn termination sequence T7 term T7 terminator 1526 1544