DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_cHalo_DC


Vector Name: pJFT7_cHalo_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: ''


Sequencing Primer: Forward:  NAP150
Reverse:  cHaloseqR
Description: In vitro expression vector with T7 promoter and C-terminal TEV-cleavable Halo tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments: Modified from pANT7_cGST, can be used for either Gateway or Flexi cloning, contains Gateway Death Cassette
Size (bp): 6205
Empty Vector: EvNO00424523
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Center for Personalized Diagnostics
Joshua LaBaer
Justin Saul
Fernanda Festa
Publications: PMID: 201200062
Title: A versatile protein microarray platform enabling antibody profiling against denatured proteins.

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3490 4172
bacterial origin M13 Ori M13 origin 5566 3021
death cassette ccdB ccdB death cassette (removed in clones with insert) 556 2210
death cassette ccdB (BsrGI removed) ccdB death cassette with BsrGI restriction site removed 1765 2070
enhancer CITE cap-independent translational enhancer (CITE) 17 515
primer M13 forward M13 forward sequencing primer 6165 6182
primer NAP150 NAP150 forward sequencing primer cccattgtatgggatctgatc 388 408
primer cHaloseqR cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT 2351 2369
promoter T7 T7 promoter 6181 6205
protease cleavage site TEV TEV protease cleavage site (EDLYFQS) 2258 2278
recombination site attR1 recombinational cloning site 531 555
recombination site attR2 recombinational cloning site 2211 2235
reporter gene LacZ LacZ alpha gene 6026 6094
selectable marker AmpR ampicillin resistance gene 4270 4929
selectable marker CmR chloramphenicol resistance gene (removed in plasmids with insert) 764 1420
tag HALO C-terminal Halo tag 2294 3178
trxn termination sequence T7 term T7 termination 3250 3268