Detailed Vector Information: pJSP6_nHalo_DC

Vector Name:
pJSP6_nHalo_DC
Synonyms:
''
Sequencing Primer:
Forward:  HaloseqF
Reverse:  pF1KseqR
Description:
Wheat germ expression vector with a SP6 promoter and N-terminal TEV-cleavable HALO tag; ampicillin resistance in bacteria and chloramphenicol resistance in empty vector; Gateway or Flexi cloning
Comments:
Modified from pEU_HSBC, can be used for either Gateway or Flexi cloning, contains Gateway Death Cassette
Size (bp):
6460
Parent Vector:
None
Properties:
Gateway, acceptor (destination), cell-free expression, recombinational cloning, with tag/fusion/marker
Author Name:
Arizona State University
Joshua LaBaer
Ji Qiu
Justin Saul
Center for Personalized Diagnostics
Publications:
None
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
IRES
TMV Omega
TMV Omega IRES
9
131
bacterial origin
ColE
ColE1 bacterial origin
3914
4596
death cassette
ccdB
Gateway ccdB death cassette - not present in plasmids containing a gene insert
1096
2750
primer
forward primer
HaloseqF forward sequencing primer aagcctgcctaactgcaa
902
919
primer
reverse primer
pFK1seqR reverse sequencing primer CTTTCGGGCTTTGTTAGCAG
2848
2867
promoter
SP6
SP6 promoter
6444
6460
protease cleavage site
TEV
TEV protease cleavage site EDLYFQS
1035
1055
recombination site
attR1
attR1 Gateway recombinational cloning site
1071
1095
recombination site
attR2
attR2 Gateway recombinational cloning site
2751
2775
selectable marker
AmpR
Ampicillin resistance gene
4694
5353
selectable marker
CmR
Chloramphenicol resistance
1304
1960
tag
HALO
N-terminal Halo tag
132
1022
trxn termination sequence
T7 term
T7 terminator
2830
2847