DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJSP6_nHalo_DC

TOP

Vector Name: pJSP6_nHalo_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pJSP6_nHalo_DC

Sequencing Primer: Forward:  HaloseqF
Reverse:  pF1KseqR
Description: Wheat germ expression vector with a SP6 promoter and N-terminal TEV-cleavable HALO tag; ampicillin resistance in bacteria and chloramphenicol resistance in empty vector; Gateway or Flexi cloning
Comments: Modified from pEU_HSBC, can be used for either Gateway or Flexi cloning, contains Gateway Death Cassette
Size (bp): 6460
Empty Vector: EvNO00450883
Parent Vector: None
Properties: Gateway, acceptor (destination), cell-free expression, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
IRES TMV Omega TMV Omega IRES 9 131
bacterial origin ColE ColE1 bacterial origin 3914 4596
death cassette ccdB Gateway ccdB death cassette - not present in plasmids containing a gene insert 1096 2750
primer forward primer HaloseqF forward sequencing primer aagcctgcctaactgcaa 902 919
primer reverse primer pFK1seqR reverse sequencing primer CTTTCGGGCTTTGTTAGCAG 2848 2867
promoter SP6 SP6 promoter 6444 6460
protease cleavage site TEV TEV protease cleavage site EDLYFQS 1035 1055
recombination site attR2 attR2 Gateway recombinational cloning site 2751 2775
recombination site attR1 attR1 Gateway recombinational cloning site 1071 1095
selectable marker CmR Chloramphenicol resistance 1304 1960
selectable marker AmpR Ampicillin resistance gene 4694 5353
tag HALO N-terminal Halo tag 132 1022
trxn termination sequence T7 term T7 terminator 2830 2847