Detailed Vector Information: pCMV(delta4)

Vector Name:
pCMV(delta4)
Synonyms:
WISP12-95
Sequencing Primer:
Forward:  pcDNAF
Reverse:  pcDNAR
Description:
Mammalian expression vector with a deletion mutant of the CMV promoter; ampicillin resistance in bacteria, neomycin resistance in mammalian cells; restriction enzyme cloning
Comments:
Empty vector Sundquist Lab internal database number = WISP12-95. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp):
4988
Parent Vector:
Name: pCMV(WT)
Description: Vector containing the full length CMV promoter
Properties:
mammalian expression, multiple cloning site
Author Name:
University of Utah
Wesley I. Sundquist
Eiji Morita
Jun Arii
Jorg Votteler
Publications:
PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 origin
3215
3897
primer
forward primer
pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC
576
599
primer
reverse primer
pcDNAR reverse 3' sequencing primer AACTAGAAGGCACAGTCGAGGCTG
341
367
promoter
CMV
Truncated CMV promoter
234
424
selectable marker
AmpR
ampicillin resistance
3995
4654
selectable marker
NeoR
neomycin resistance (mammalian cells)
1696
2487
ssDNA origin
f1
f1 origin
872
1178