DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nGST_DC-r2

TOP

Vector Name: pJFT7_nGST_DC-r2
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pJFT7_nGST_DC-r2

Sequencing Primer: Forward:  GSTseqF
Reverse:  pCPD6268_R
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: One in a series of pJFT7 vectors made by J. Saul for IVTT protein expression at CPD. This vector has been modified to improve sequencing the insert with a reverse primer.
Size (bp): 6012
Empty Vector: EvNO00623103
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 3297 3979
death cassette ccdB ccdB death cassette (removed in plasmids containing a gene insert) 2572 2781
enhancer CITE CITE enhancer 17 515
primer reverse pCPD6268_R reverse sequencing primer agccaactcagcttccttt 2993 3011
primer forward primer GSTseqF forward sequencing primer GCAAGTATATAGCATGGCCT 1105 1124
promoter T7 T7 promoter 5997 6012
protease cleavage site TEV TEV protease cleavage site 1209 1229
recombination site attR1 attR1 recombination site 1245 1261
recombination site attR2 attR1 recombination site 2932 2947
reporter gene LacZ LacZ alpha 5833 5901
selectable marker AmpR Ampicillin resistance 4407 4736
selectable marker CmR chloramphenicol resistance (removed in plasmids containing a gene insert) 1478 2134
ssDNA origin f1 f1 origin 5505 5811
tag GST N-terminal GST tag 525 1190
trxn termination sequence T7 term T7 terminator 3069 3115