DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pRSET-natGFP

TOP

Vector Name: pRSET-natGFP
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pRSET-natGFP

Sequencing Primer: Forward:  T7
Reverse:  GFPR
Description: Bacterial expression vector with a T7 promoter; adds C-terminal GFP tag; ampicillin resistance in bacteria; ligation independent cloning
Comments: Based on Invitrogen pRSET B. Vector for subcloning to produce C-terminal GSAGSAAGSGEF linker + GFP tag. Insert not expressed due to ~0.5 kb BseRI-flanked sequence, containing stop codons in all three frames, between the RBS and GFP. Subclone using BseRI digestion and Clontech In-Fusion ligase-independent cloning. See Martin-Garcia et al 2014 Biochemistry 53:1958, PMID 24593131
Size (bp): 3980
Empty Vector: EvNO00623703
Parent Vector: None
Properties: bacterial expression, fluorescent marker, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: PSI:Biology
Arizona State University
Center for Membrane Proteins in Infectious Diseases
Publications: PMID: 24593131
Title: Purification and Biophysical Characterization of the CapA Membrane Protein FTT0807 from Francisella tularensis.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC bacterial origin 3080 3862
primer reverse primer GFPR reverse sequencing primer TCTCCACTGACAGAAAATTTGTGC 642 665
promoter T7 T7 promoter 20 39
ribosome binding site RBS Ribosome binding site 85 92
selectable marker AmpR ampicillin resistance 2125 2985
ssDNA origin f1 f1 origin 1539 1994
tag GFP C-terminal rGFP tag 568 1287
trxn termination sequence T7 term T7 terminator 1339 1468