DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMVi-UB

TOP

Vector Name: pCMVi-UB
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pCMVi-UB

Sequencing Primer: Forward:  UBFOR
Reverse:  HGHTER
Description: Vector for antibody production in mice upon genetic immunization by gene gun with CMV promoter and N-terminal mouse ubiqiutin protein with Gly76Ala mutation; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: The mouse ubiquitin sequence contains the C-terminal Gly76Ala mutation to prevent de-ubiquination. Clone insert in-frame using the BglII restriction sites and another downstream site before the transcription terminator (such as XmaI)
Size (bp): 5218
Empty Vector: EvNO00629006
Parent Vector: None
Properties: mammalian expression, multiple cloning site, with tag/fusion/marker
Author Name: Arizona State University
Kathryn Sykes
Stephen Johnston
Publications: PMID: 10433551
Title: Genetic live vaccines mimic the antigenicity but not pathogenicity of live viruses.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE CoE1 bacterial origin 2894 3750
gene fragment ubiquitin N-terminal mouse ubiquitin protein with Gly76Ala mutation 1250 1476
intron intron Intron 1028 1160
primer forward primer UBFOR sequencing primer AACATCCAGAAGGAGTCA 1427 1444
primer reverse primer HGHTER reverse sequencing primer ACTGGAGTGGCAACTTCCAGG 1594 1614
promoter CMV CMV promoter 174 915
selectable marker AmpR Ampicillin resistance 3760 4670
ssDNA origin f1 f1 origin 4752 5204
trxn regulatory element hGH hGH terminator 1556 2032