| Gene 1: |
Gene Symbol:
Heavy chain Gene Name:  Heavy chain |
|---|---|
| Gene 2: |
Gene Symbol:
Light chain Gene Name:  Light chain Sequence |
| Original Clone ID: | anti-TSC22D4-RAB-S10 |
| Keyword: | anti-TSC22D4-RAB-S10 recombinant antibody fab fragment |
| Species: | Homo sapiens |
| Type: | cDNA |
| Vector Name: | pFab007 Format: FUSION |
| Source: | Recombinant Antibody Network |
| Description: | None |
| Comments: | None |
| Mutation/ Discrepancy : |
No / No |
| Publications: | None |
| Authors: |
University of California San Francisco Recombinant Antibody Network Protein Capture Reagents Program |
|
HsCD00601571 Price: Login for Pricing AVAILABLE No restriction Special MTA: SPTA |
Insert sequence: 255nts
Open reading frame : 1 to 255 & 1 to 255
ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACATCTATTATTATTCTATC
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTATCCTTAT
TATGGCTCTACTTAT
ATGAAATACCTATTGCCTACGGCAGCCGCTGGCTTGCTGCTGCTGGCGGCCCAGCCGGCC
ATGGCGTCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGAT
AGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTATCAA
CAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCTGGA
GTCCCTTCTCGCTTC
|
| Coding Sequence Details | |
|---|---|
| Insert Sequence Verified?: Y | Verification Method: Sequence Verification |
|
Mutations: None |
Discrepancy: None |
| 5' Linker Sequence: None | |
| 3' Linker Sequence: None | |
| Distributed in bacterial strain : | DH5-alpha T1 phage resistant |
|---|---|
| Antibiotic Selection: |
Host Type:
bacterial
Marker:
ampicillin Bacterial Selection Condition: 100 ug/mL ampicillin Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended. Comments: Commonly used conditions for ampicillin resistant plasmid clones. |
| Protein Expression Results: | None |
| Recommended expression in: | Not Applicable |
  Powered by LabGenius |
||
| Vector Name: | pFab007 | |
| Synonyms: | '' | |
| Description: | Recombinant antibody expression vector with STII periplasm export sequences; ampicillin resistance in bacteria | |
| Comments: | None | |
| Size (bp): | 5214 | |
| Parent Vector: | None | |
| Empty Vector: | None | |
| Properties: | bacterial expression, with tag/fusion/marker | |
| Author Name: |
University of Chicago Recombinant Antibody Network |
|
| Publications: | None | |
| Vector Map: |
Vector Sequence:
|
|
| Sequence: |
Vector Features:
| Type | Name | Description | Start Position | End Position |
|---|---|---|---|---|
| bacterial origin | ColE | ColE1 origin | 4336 | 4128 |
| primer | forward primer | For heavy chain CDRs: FabHCupF: 5 GGACGCATCGTGGCCC 3 | 1571 | 1586 |
| primer site | forward | light chain CDR: FabLCupF: 5 CTGTCATAAAGTTGTCACGG 3 | 688 | 707 |
| promoter | T7 | T7 promoter | 3115 | 3142 |
| secretion signal sequence | STII | STII periplasm export sequence | 804 | 873 |
| selectable marker | AmpR | ampicillin resistance | 4226 | 4885 |
| ssDNA origin | f1 | f1 origin | 135 | 441 |
| tag | V5 | V5 epitope tag | 2428 | 2469 |
- Protein
- Clone
Protein
| PCRP Binder Details : | anti-TSC22D4-RAB-S10 |
|---|
Clone
| Cloning Information : | 662844 |
|---|---|
| Original Clone ID : | anti-TSC22D4-RAB-S10 |

