DNASU Plasmid Repository • 480.965.5697 | Email

Sequencing Primers

TOP

DNASU uses various primers to sequence verify gene inserts for most of the plasmids avialable in the repository. For a full list of vectors and their sequencing primers, go to our Vector/Primer page.

If you are interested in Sanger or Next Generation sequencing Services, please refer to our Sequencing Core website for more information.

Common Sequencing Primers

Primer Name Primer Sequence
AttP2 CAGGAAACAGCTATGAC
M13F GTAAAACGACGGCCAGT
M13R CAGGAAACAGCTATGACC
NAP138R TGTTTCGCCATTTATCACCTTC
NAP150 CCCATTGTATGGGATCTGATC
T7 TAATACGACTCACTATAG
T7 terminator GCTAGTTATTGCTCAGCGG
U19 GTTTTCCCAGTCACGACGT

 

All Sequencing Primers

Primer Name Primer Sequence
alt_bad_rev GGGTCAGGTGGGACCAC
ANForward CGTTTCCAGTCTCACCACC
AOX1 GACTGGTTCCAATTGACAAGC
ARAC5R GGGATCATTTTGCGCTTCAG
AttP2 CAGGAAACAGCTATGAC
CAGF TCGGCTTCTGGCGTGTGACC
CAGR TGTCCCCATAATTTTTGGCAGAGG
cHaloseqR CAACATCGACGTAGTGCAT
CMV forward CGCAAATGGGCGGTAGGCGTG
DD122B GTTAGGCGTTTTGCGCTG
DD123B GCTGGCAACTAGAAGGCAC
DuetUp1 GGATCTCGACGCTCTCCCT
EGFP-C CATGGTCCTGCTGGAGTTCGTG
EGFP-N CGTCGCCGTCCAGCTCGACCAG
FasBacFwd ATACCGTCCCACCATCG
FastBacRev GATCCTCTAGTACTTCTCG
GFPR TCTCCACTGACAGAAAATTTGTGC
GST Forward CTTCGATAGGGTGTTTAACT
GSTseqF GCAAGTATATAGCATGGCCT
HaloseqF AAGCCTGCCTAACTGCAA
HGHTER ACTGGAGTGGCAACTTCCAGG
His2 Forward AGAAAGTTTATGAAGATCGATCTCAT
ISFI_newrev TTTGTTAGCAGCCGGATCTCAGTGG
IST1_728 CGCCTTTCTCATATCCAC
JPO113 GCGGTTTTGGCAGTACATCAATGGGCG
LPP2 GATCAAAAATAAGTGGCGCCCCATC
LSFOR TTCTGTCTCGTGGGGCAT
M13F GTAAAACGACGGCCAGT
M13R CAGGAAACAGCTATGACC
malE GGTCGTCAGACTGTCGATGAAGCC
MBP Forward CTACAGGCGAAAGACCATACG
MBPpelBseqF GAAAGGTGAAATCATGCCGAACATC
MBPSeq Forward TCGTCAGACTGTCGATGAAG
MCSG73F TATGGCTGCCCGTAATAACAACAAC
nap1273r TAAACGTTCAATTGCTATTATCACG
NAP138R TGTTTCGCCATTTATCACCTTC
NAP150 CCCATTGTATGGGATCTGATC
P139 GAGGGCCTATTTCCCATGATTCCTT
p28mis forward CGAACCGCTGATCCAACTGG
p28mis reverse GATATAGTTCCTCCTTTCAGC
p4 GGTTTAAACGGATCCAGC
pant1491R TTTTTGTTTAAACTACCACTTT
pant1627r CCGGATATAGTTCCTCCTTT
pAOX1 Reverse GCAAATGGCATTCTGACATCC
PB22F GAGGAATTCACCATGCGCTATATC
PB22R CAATAAGGAAAACTACTAAAAGAGCTTC
pBABE 3' ACCCTAACTGACACACATTCC
pBABE 5' CTTTATCCAGCCCTCAC
pBAD forward ATGCCATAGCATTTTTATCC
PBADF CGCAACTCTCTACTGTTTCTCC
PBADFOR GCACGGCGTCACACTTTGC
PBADR CCGCTTCTGCGTTCTGATTTAATCTG
pBADrev TAGTTATTGCTCAGCGGTGG
pBRrevBam_Primer GGTGATGTCGGCGATATAGG
pBRrevBqm_Primer GGTGATGTCGGCGATATAGG
pCDNA F TTAATACGACTCACTATAGGG
pcDNAF AGAGAACCCACTGCTTACTGGCTTATC
pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCPD5698_F AATTCATGGACGAGAAGACC
pCPD5698_F AATTCATGGACGAGAAGACC
pCPD6268_R AGCCAACTCAGCTTCCTTT
pCPD6268_R AGCCAACTCAGCTTCCTTT
pDONR201-forward GTAACATCAGAGATTTTGAGACAC
pDONR201-reverse TCGCGTTAACGCTAGCATGGATCTC
pET Upstream ATGCGTCCGGCGTAGA
pEU Reverse CCCGCTTCGCCGCCGCAGAAT
pEU319 Forward GTCGTTAGAACGCGGCTAC
pEUfor GGTGACACTATAGAACTCA
pEUrev GGCGCTAGCCGTAAATTCT
pF1KseqR CTTTCGGGCTTTGTTAGCAG
pFAB007 GGACGCATCGTGGCCC
pFB Forward TATTCCGGATTATTCATACC
pFB Reverse ACAAATGTGGTATGGCTGATT
pGEc1-DEST F AGAGCTGGTTTAGTGAACCGTC
pGEn1-DEST R TGACAACGGGCCACAACTCCTC
pGEn2-DEST F GACAATCACTACCTGAGCACCA
pGEn3-DEST-5'F AGCATGCACCACCACCATCACC
pGEX3 CCGGGAGCTGCATGTGTCAGAGG
pGEX5 GGGCTGGCAAGCCACGTTTGGTG
PGEXF GGTGGTGGCGACCATCCTCC
PGEXR GGTTTTCACCGTCATCACCG
Phsp AGGTGACCACAACGACGC
Phsp AGGTGACCACAACGACGC
pIEx Forward AACCTCTACTTCCAATCGCACCATCATCACCACCATTG
pIEx Reverse TATATCTCCTTCTTAAGGTTAAACAAAATTATTTCTAG
pIEx_seq_F GCGACAAGATCGTGAACAAC
pIEx_seq_R ACGGCCCCTCGATAATAAAA
pLIC rev AGCAGCCAACTCAGCTTCC
pLICf TGTGAGCGGATAACAATTCC
pMal TGTCCTACTCAGGAGAGCGTTCAC
pMCSG48F GAAGGGTTGACCGACGAAAAAGC
pMHTDelta238-F ACGCCCAGAAAGGTGAAATCATGC
pMHTDelta238-R TGAGTCGCTTCCTTAACTGGCTGA
pPIC3-5F GACTGGTTCCAATTGACAAGC
pPIC3-5R GCAAATGGCATTCTGACATCC
pQE Reverse CAAGACTCCAGTAATGACC
PQEREV GTTCTGAGGTCATTACTGG
Ps-Pimyc CTGTTTAAACGGATCGTCG
pSGP-Forward CAACATTTTCAGTTTGTATTACTTC
pSGP-Reverse CAATCAACTATCAACTATTAACTA
pSGP18for CACCTGTGCCGAAACGCAAATG
pSGP36 forward CAACATTTTCAGTTTGTATTACTTC
pSGP36 reverse CAAGGCGATTAAGTTGGGTAACGC
pSUPER-for GGAAGCCTTGGCTTTTG
PtetO GGATCGTCGGCACCGTCA
RRNBTER TCTGCGTTCTGATTTAATCTGTATCA
snap_484F CTCGCCGTGAAAGAGTGG
SP6 CATACGATTTAGGTGACACTATAG
T3 ATTAACCCTCACTAAAGGGA
T7 TAATACGACTCACTATAG
T7 EEV AAGGCTAGAGTACTTAATACGA
T7 For TAATACGACTCACTATAGGG
T7 short TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGG
T7p AATTAATACGACTCACTATAGGG
T7short TAATACGACTCACTATAGGG
T7t ATGCTAGTTATTGCTCAGCGG
TEV GAAAACCTGTACTTCCAG
TRXF GTTGAAAGAGTTCCTCGACG
TTFOR CAACAACTTCACCGTGAGC
U19 GTTTTCCCAGTCACGACGT
UBFOR AACATCCAGAAGGAGTCA
V5 reverse ACCGAGGAGAGGGTTAGGGAT
YFP CATCAAGGTGAACTTCAAGA